EMAIL THIS PAGE TO A FRIEND

ZCCHC13

zinc finger, CCHC domain containing 13

Synonyms: CNBP2 ZNF9L
UniProtKB ID: Q8WW36
Gene ID:
Human(389874) Summary: This gene appears to represent an intronless retrocopy of a related multi-exon gene located on chromosome 3. However, the CDS of this intronless gene remains relatively intact, it is conserved in other mammalian species, it is known to be transcribed, and it is therefore thought to encode a functional protein. The encoded protein contains six CCHC-type zinc fingers, and is thus thought to function as a transcription factor. [provided by RefSeq, May 2010]
Mouse(75064) zinc finger, CCHC domain containing 13
Rat(302399) zinc finger, CCHC domain containing 13
cow(785599) zinc finger protein 9
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203303 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203303 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203303 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029158 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029158 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029158 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040721 MISSION® esiRNA esiRNA human ZCCHC13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203303 Rosetta Predictions human pricing
XM_001055840 Rosetta Predictions rat pricing
NM_029158 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203303 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043360 predicted 313
2 SASI_Hs02_00373235 predicted 290
3 SASI_Hs01_00043361 predicted 328
4 SASI_Hs01_00043362 predicted 199
5 SASI_Hs01_00043363 predicted 205
6 SASI_Hs01_00043364 predicted 299
7 SASI_Hs01_00043365 predicted 241
8 SASI_Hs01_00043366 predicted 232
9 SASI_Hs01_00043368 predicted 321
10 SASI_Hs02_00373236 predicted 338
11 SASI_Hs01_00043367 predicted 311
12 SASI_Hs01_00043369 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055840 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281197 predicted 280
2 SASI_Rn02_00281198 predicted 232
3 SASI_Rn02_00281199 predicted 255
4 SASI_Rn02_00281200 predicted 257
5 SASI_Rn02_00281201 predicted 257
6 SASI_Rn02_00281202 predicted 255
7 SASI_Rn02_00281203 predicted 218
8 SASI_Rn02_00281204 predicted 273
9 SASI_Rn02_00281205 predicted 280
10 SASI_Rn02_00281206 predicted 260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029158 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130601 predicted 447
2 SASI_Mm01_00130602 predicted 823
3 SASI_Mm01_00130603 predicted 675
4 SASI_Mm01_00130605 predicted 615
5 SASI_Mm01_00130606 predicted 209
6 SASI_Mm01_00130607 predicted 341
7 SASI_Mm01_00130608 predicted 778
8 SASI_Mm01_00130609 predicted 556
9 SASI_Mm01_00130610 predicted 474
10 SASI_Mm02_00334968 predicted 269
11 SASI_Mm01_00130604 predicted 854
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203303
ZCCHC13 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 13
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203303.2-225s21c1
Sequence:CCGGTGTGGTGAGTCCGGTCGTAATCTCGAGATTACGACCGGACTCACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203303.2-334s21c1
Sequence:CCGGAGAGACGCCAACACTGTTATACTCGAGTATAACAGTGTTGGCGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203303.2-573s21c1
Sequence:CCGGCAGTGAGGTTACCACTTAAATCTCGAGATTTAAGTGGTAACCTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203303.2-300s21c1
Sequence:CCGGCACATCGCCAAAGACTGTAAGCTCGAGCTTACAGTCTTTGGCGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034194    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203303.1-688s1c1
Sequence:CCGGCTCAGGCAAGTGAGCTTTAATCTCGAGATTAAAGCTCACTTGCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203303.1-548s1c1
Sequence:CCGGCCCGACATCTAGCCAAGGAATCTCGAGATTCCTTGGCTAGATGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203303.1-390s1c1
Sequence:CCGGGATCGTCAGAAAGAGCAGAAACTCGAGTTTCTGCTCTTTCTGACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203303.1-175s1c1
Sequence:CCGGGCAGAGGTTCTCAATGTGGTTCTCGAGAACCACATTGAGAACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203303
ZCCHC13 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 13
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203303.2-225s21c1
Sequence:CCGGTGTGGTGAGTCCGGTCGTAATCTCGAGATTACGACCGGACTCACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203303.2-334s21c1
Sequence:CCGGAGAGACGCCAACACTGTTATACTCGAGTATAACAGTGTTGGCGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203303.2-573s21c1
Sequence:CCGGCAGTGAGGTTACCACTTAAATCTCGAGATTTAAGTGGTAACCTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203303.2-300s21c1
Sequence:CCGGCACATCGCCAAAGACTGTAAGCTCGAGCTTACAGTCTTTGGCGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034194    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203303.1-688s1c1
Sequence:CCGGCTCAGGCAAGTGAGCTTTAATCTCGAGATTAAAGCTCACTTGCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203303.1-548s1c1
Sequence:CCGGCCCGACATCTAGCCAAGGAATCTCGAGATTCCTTGGCTAGATGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203303.1-390s1c1
Sequence:CCGGGATCGTCAGAAAGAGCAGAAACTCGAGTTTCTGCTCTTTCTGACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203303.1-175s1c1
Sequence:CCGGGCAGAGGTTCTCAATGTGGTTCTCGAGAACCACATTGAGAACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203303
ZCCHC13 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 13
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203303.2-225s21c1
Sequence:CCGGTGTGGTGAGTCCGGTCGTAATCTCGAGATTACGACCGGACTCACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203303.2-334s21c1
Sequence:CCGGAGAGACGCCAACACTGTTATACTCGAGTATAACAGTGTTGGCGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203303.2-573s21c1
Sequence:CCGGCAGTGAGGTTACCACTTAAATCTCGAGATTTAAGTGGTAACCTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203303.2-300s21c1
Sequence:CCGGCACATCGCCAAAGACTGTAAGCTCGAGCTTACAGTCTTTGGCGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034194    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203303.1-688s1c1
Sequence:CCGGCTCAGGCAAGTGAGCTTTAATCTCGAGATTAAAGCTCACTTGCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203303.1-548s1c1
Sequence:CCGGCCCGACATCTAGCCAAGGAATCTCGAGATTCCTTGGCTAGATGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203303.1-390s1c1
Sequence:CCGGGATCGTCAGAAAGAGCAGAAACTCGAGTTTCTGCTCTTTCTGACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203303.1-175s1c1
Sequence:CCGGGCAGAGGTTCTCAATGTGGTTCTCGAGAACCACATTGAGAACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029158
ZCCHC13 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 13
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029158.1-635s1c1
Sequence:CCGGCGCTGTTTCTAACATTTCTTTCTCGAGAAAGAAATGTTAGAAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029158.1-452s1c1
Sequence:CCGGCCAGAAAGATTGTACCCAAATCTCGAGATTTGGGTACAATCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029158.1-286s1c1
Sequence:CCGGCCTGCTACAACTGCGGGAGAACTCGAGTTCTCCCGCAGTTGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029158.1-476s1c1
Sequence:CCGGGTGCTACAGATGTGGTGAGAACTCGAGTTCTCACCACATCTGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029158.1-466s1c1
Sequence:CCGGCCCAAATTAAGTGCTACAGATCTCGAGATCTGTAGCACTTAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029158
ZCCHC13 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 13
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029158.1-635s1c1
Sequence:CCGGCGCTGTTTCTAACATTTCTTTCTCGAGAAAGAAATGTTAGAAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029158.1-452s1c1
Sequence:CCGGCCAGAAAGATTGTACCCAAATCTCGAGATTTGGGTACAATCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029158.1-286s1c1
Sequence:CCGGCCTGCTACAACTGCGGGAGAACTCGAGTTCTCCCGCAGTTGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029158.1-476s1c1
Sequence:CCGGGTGCTACAGATGTGGTGAGAACTCGAGTTCTCACCACATCTGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029158.1-466s1c1
Sequence:CCGGCCCAAATTAAGTGCTACAGATCTCGAGATCTGTAGCACTTAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029158
ZCCHC13 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 13
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029158.1-635s1c1
Sequence:CCGGCGCTGTTTCTAACATTTCTTTCTCGAGAAAGAAATGTTAGAAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029158.1-452s1c1
Sequence:CCGGCCAGAAAGATTGTACCCAAATCTCGAGATTTGGGTACAATCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029158.1-286s1c1
Sequence:CCGGCCTGCTACAACTGCGGGAGAACTCGAGTTCTCCCGCAGTTGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029158.1-476s1c1
Sequence:CCGGGTGCTACAGATGTGGTGAGAACTCGAGTTCTCACCACATCTGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029158.1-466s1c1
Sequence:CCGGCCCAAATTAAGTGCTACAGATCTCGAGATCTGTAGCACTTAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks