EMAIL THIS PAGE TO A FRIEND

ZCCHC14

zinc finger, CCHC domain containing 14

Synonyms: BDG-29 BDG29
UniProtKB ID: Q8WYQ9, D3DUN1, O60324, Q3MJD8, Q9UFP0
Gene ID:
Mouse(142682) zinc finger, CCHC domain containing 14
Rat(365018) zinc finger, CCHC domain containing 14
Zebrafish(796219) zinc finger, CCHC domain containing 14
Horse(100070592) zinc finger, CCHC domain containing 14
chicken(415829) zinc finger, CCHC domain containing 14
dog(100684496) zinc finger, CCHC domain containing 14
domestic cat(101095939) zinc finger, CCHC domain containing 14
domestic guinea pig(100726593) zinc finger, CCHC domain containing 14
naked mole-rat(101709584) zinc finger, CCHC domain containing 14
Domestic Rabbit(100349721) zinc finger, CCHC domain containing 14
cow(528171) zinc finger, CCHC domain containing 14
sheep(101104775) zinc finger, CCHC domain containing 14
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015144 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015144 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015144 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080855 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080855 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080855 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015144 Rosetta Predictions human pricing
XM_001079169 Rosetta Predictions rat pricing
XM_344780 Rosetta Predictions rat pricing
NM_080855 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015144 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055940 predicted 1009
2 SASI_Hs01_00055941 predicted 388
3 SASI_Hs01_00055942 predicted 2799
4 SASI_Hs01_00055943 predicted 452
5 SASI_Hs01_00055944 predicted 1985
6 SASI_Hs01_00055945 predicted 439
7 SASI_Hs01_00055946 predicted 2706
8 SASI_Hs01_00055947 predicted 1568
9 SASI_Hs02_00347083 predicted 966
10 SASI_Hs01_00055948 predicted 2941
11 SASI_Hs01_00055949 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079169 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00363339 predicted 801
2 SASI_Rn02_00363340 predicted 929
3 SASI_Rn02_00363341 predicted 2079
4 SASI_Rn02_00363342 predicted 1089
5 SASI_Rn02_00363343 predicted 2398
6 SASI_Rn02_00363344 predicted 852
7 SASI_Rn02_00363345 predicted 925
8 SASI_Rn02_00363346 predicted 888
9 SASI_Rn02_00363347 predicted 988
10 SASI_Rn02_00363348 predicted 976
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344780 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397525 predicted 787
2 SASI_Rn02_00397526 predicted 916
3 SASI_Rn02_00397527 predicted 2067
4 SASI_Rn02_00397528 predicted 1081
5 SASI_Rn02_00397529 predicted 2386
6 SASI_Rn02_00397530 predicted 843
7 SASI_Rn02_00397531 predicted 908
8 SASI_Rn02_00397532 predicted 873
9 SASI_Rn02_00397533 predicted 974
10 SASI_Rn02_00397534 predicted 962
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080855 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169725 predicted 1228
2 SASI_Mm01_00169726 predicted 991
3 SASI_Mm01_00169727 predicted 412
4 SASI_Mm01_00169728 predicted 543
5 SASI_Mm01_00169729 predicted 634
6 SASI_Mm01_00169730 predicted 420
7 SASI_Mm01_00169732 predicted 2017
8 SASI_Mm01_00169733 predicted 384
9 SASI_Mm01_00169734 predicted 554
10 SASI_Mm02_00338229 predicted 643
11 SASI_Mm01_00169731 predicted 422
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015144
VALIDATED
ZCCHC14 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 14
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015144.1-228s1c1
Sequence:CCGGGTCAGTAATAGTTTGGAGAATCTCGAGATTCTCCAAACTATTACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015144.1-2744s1c1
Sequence:CCGGCGGGAACCTATCTTGTTACAACTCGAGTTGTAACAAGATAGGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015144.1-682s1c1
Sequence:CCGGCCTCCCTTTCTAAAGTAGGTACTCGAGTACCTACTTTAGAAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015144.1-436s1c1
Sequence:CCGGCCTCTGAAGTGACGGAATTTACTCGAGTAAATTCCGTCACTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015144.1-2002s1c1
Sequence:CCGGCCTGTCCTAATAATGTGCAAACTCGAGTTTGCACATTATTAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015144.2-1994s21c1
Sequence:CCGGCCTGTCCTAATAATGTGCAAACTCGAGTTTGCACATTATTAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015144.2-220s21c1
Sequence:CCGGGTCAGTAATAGTTTGGAGAATCTCGAGATTCTCCAAACTATTACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015144.2-674s21c1
Sequence:CCGGCCTCCCTTTCTAAAGTAGGTACTCGAGTACCTACTTTAGAAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015144.2-428s21c1
Sequence:CCGGCCTCTGAAGTGACGGAATTTACTCGAGTAAATTCCGTCACTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015144.2-2736s21c1
Sequence:CCGGCGGGAACCTATCTTGTTACAACTCGAGTTGTAACAAGATAGGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015144
VALIDATED
ZCCHC14 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 14
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015144.1-228s1c1
Sequence:CCGGGTCAGTAATAGTTTGGAGAATCTCGAGATTCTCCAAACTATTACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015144.1-2744s1c1
Sequence:CCGGCGGGAACCTATCTTGTTACAACTCGAGTTGTAACAAGATAGGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015144.1-682s1c1
Sequence:CCGGCCTCCCTTTCTAAAGTAGGTACTCGAGTACCTACTTTAGAAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015144.1-436s1c1
Sequence:CCGGCCTCTGAAGTGACGGAATTTACTCGAGTAAATTCCGTCACTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015144.1-2002s1c1
Sequence:CCGGCCTGTCCTAATAATGTGCAAACTCGAGTTTGCACATTATTAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015144.2-1994s21c1
Sequence:CCGGCCTGTCCTAATAATGTGCAAACTCGAGTTTGCACATTATTAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015144.2-220s21c1
Sequence:CCGGGTCAGTAATAGTTTGGAGAATCTCGAGATTCTCCAAACTATTACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015144.2-674s21c1
Sequence:CCGGCCTCCCTTTCTAAAGTAGGTACTCGAGTACCTACTTTAGAAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015144.2-428s21c1
Sequence:CCGGCCTCTGAAGTGACGGAATTTACTCGAGTAAATTCCGTCACTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015144.2-2736s21c1
Sequence:CCGGCGGGAACCTATCTTGTTACAACTCGAGTTGTAACAAGATAGGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015144
VALIDATED
ZCCHC14 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 14
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015144.1-228s1c1
Sequence:CCGGGTCAGTAATAGTTTGGAGAATCTCGAGATTCTCCAAACTATTACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015144.1-2744s1c1
Sequence:CCGGCGGGAACCTATCTTGTTACAACTCGAGTTGTAACAAGATAGGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015144.1-682s1c1
Sequence:CCGGCCTCCCTTTCTAAAGTAGGTACTCGAGTACCTACTTTAGAAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015144.1-436s1c1
Sequence:CCGGCCTCTGAAGTGACGGAATTTACTCGAGTAAATTCCGTCACTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015144.1-2002s1c1
Sequence:CCGGCCTGTCCTAATAATGTGCAAACTCGAGTTTGCACATTATTAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015144.2-1994s21c1
Sequence:CCGGCCTGTCCTAATAATGTGCAAACTCGAGTTTGCACATTATTAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015144.2-220s21c1
Sequence:CCGGGTCAGTAATAGTTTGGAGAATCTCGAGATTCTCCAAACTATTACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015144.2-674s21c1
Sequence:CCGGCCTCCCTTTCTAAAGTAGGTACTCGAGTACCTACTTTAGAAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015144.2-428s21c1
Sequence:CCGGCCTCTGAAGTGACGGAATTTACTCGAGTAAATTCCGTCACTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015144.2-2736s21c1
Sequence:CCGGCGGGAACCTATCTTGTTACAACTCGAGTTGTAACAAGATAGGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080855
VALIDATED
ZCCHC14 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 14
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_080855.1-991s1c1
Sequence:CCGGGCACAAGTATTACCCTGTCTTCTCGAGAAGACAGGGTAATACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080855.1-264s1c1
Sequence:CCGGGCCTGGAGAATGCATTGCATACTCGAGTATGCAATGCATTCTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080855.1-637s1c1
Sequence:CCGGCGACCACGTTAGGAAGTTCTTCTCGAGAAGAACTTCCTAACGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_080855.1-2566s1c1
Sequence:CCGGCTATGTCAGTACCCAGCAGTACTCGAGTACTGCTGGGTACTGACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_080855.1-2023s1c1
Sequence:CCGGGCAGACTTCTTGTCCCAACAACTCGAGTTGTTGGGACAAGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080855.1-982s21c1
Sequence:CCGGGCTGCGCTTGCACAAGTATTACTCGAGTAATACTTGTGCAAGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080855.1-637s21c1
Sequence:CCGGCGACCACGTTAGGAAGTTCTTCTCGAGAAGAACTTCCTAACGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080855.1-3250s21c1
Sequence:CCGGCCTTCTAGGCTCACGTAATTCCTCGAGGAATTACGTGAGCCTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080855.1-2610s21c1
Sequence:CCGGTGGTACACACACCCTACAATGCTCGAGCATTGTAGGGTGTGTGTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080855.1-264s21c1
Sequence:CCGGGCCTGGAGAATGCATTGCATACTCGAGTATGCAATGCATTCTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080855
VALIDATED
ZCCHC14 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 14
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_080855.1-991s1c1
Sequence:CCGGGCACAAGTATTACCCTGTCTTCTCGAGAAGACAGGGTAATACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080855.1-264s1c1
Sequence:CCGGGCCTGGAGAATGCATTGCATACTCGAGTATGCAATGCATTCTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080855.1-637s1c1
Sequence:CCGGCGACCACGTTAGGAAGTTCTTCTCGAGAAGAACTTCCTAACGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_080855.1-2566s1c1
Sequence:CCGGCTATGTCAGTACCCAGCAGTACTCGAGTACTGCTGGGTACTGACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_080855.1-2023s1c1
Sequence:CCGGGCAGACTTCTTGTCCCAACAACTCGAGTTGTTGGGACAAGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080855.1-982s21c1
Sequence:CCGGGCTGCGCTTGCACAAGTATTACTCGAGTAATACTTGTGCAAGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080855.1-637s21c1
Sequence:CCGGCGACCACGTTAGGAAGTTCTTCTCGAGAAGAACTTCCTAACGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080855.1-3250s21c1
Sequence:CCGGCCTTCTAGGCTCACGTAATTCCTCGAGGAATTACGTGAGCCTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080855.1-2610s21c1
Sequence:CCGGTGGTACACACACCCTACAATGCTCGAGCATTGTAGGGTGTGTGTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080855.1-264s21c1
Sequence:CCGGGCCTGGAGAATGCATTGCATACTCGAGTATGCAATGCATTCTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080855
VALIDATED
ZCCHC14 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 14
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_080855.1-991s1c1
Sequence:CCGGGCACAAGTATTACCCTGTCTTCTCGAGAAGACAGGGTAATACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080855.1-264s1c1
Sequence:CCGGGCCTGGAGAATGCATTGCATACTCGAGTATGCAATGCATTCTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080855.1-637s1c1
Sequence:CCGGCGACCACGTTAGGAAGTTCTTCTCGAGAAGAACTTCCTAACGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_080855.1-2566s1c1
Sequence:CCGGCTATGTCAGTACCCAGCAGTACTCGAGTACTGCTGGGTACTGACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_080855.1-2023s1c1
Sequence:CCGGGCAGACTTCTTGTCCCAACAACTCGAGTTGTTGGGACAAGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080855.1-982s21c1
Sequence:CCGGGCTGCGCTTGCACAAGTATTACTCGAGTAATACTTGTGCAAGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080855.1-637s21c1
Sequence:CCGGCGACCACGTTAGGAAGTTCTTCTCGAGAAGAACTTCCTAACGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080855.1-3250s21c1
Sequence:CCGGCCTTCTAGGCTCACGTAATTCCTCGAGGAATTACGTGAGCCTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080855.1-2610s21c1
Sequence:CCGGTGGTACACACACCCTACAATGCTCGAGCATTGTAGGGTGTGTGTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080855.1-264s21c1
Sequence:CCGGGCCTGGAGAATGCATTGCATACTCGAGTATGCAATGCATTCTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks