EMAIL THIS PAGE TO A FRIEND

ZCCHC16

zinc finger, CCHC domain containing 16

Synonyms: Mar4 Mart4
UniProtKB ID: Q6ZR62, B2RPG1
Gene ID:
Mouse(619287) zinc finger, CCHC domain containing 16
Rat(680778) zinc finger, CCHC domain containing 16
naked mole-rat(101708494) zinc finger, CCHC domain containing 16
domestic guinea pig(100712999) zinc finger, CCHC domain containing 16
dog(492074) zinc finger, CCHC domain containing 16
domestic cat(101097216) zinc finger, CCHC domain containing 16
188 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA003272 Anti-ZCCHC16 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033795 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033795 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033795 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001004308 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004308 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004308 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU184391 MISSION® esiRNA esiRNA targeting mouse Zcchc16 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004308 Rosetta Predictions human pricing
XM_001058813 Rosetta Predictions rat pricing
NM_001033795 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004308 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243441 predicted 1283
2 SASI_Hs02_00304512 predicted 1292
3 SASI_Hs01_00243442 predicted 523
4 SASI_Hs01_00243443 predicted 782
5 SASI_Hs01_00243444 predicted 803
6 SASI_Hs01_00243445 predicted 886
7 SASI_Hs01_00243446 predicted 703
8 SASI_Hs01_00243447 predicted 1043
9 SASI_Hs01_00243448 predicted 1468
10 SASI_Hs01_00243449 predicted 1470
11 SASI_Hs01_00243450 predicted 881
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058813 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290957 predicted 651
2 SASI_Rn02_00290958 predicted 230
3 SASI_Rn02_00290959 predicted 426
4 SASI_Rn02_00290960 predicted 515
5 SASI_Rn02_00290961 predicted 596
6 SASI_Rn02_00290962 predicted 247
7 SASI_Rn02_00290963 predicted 587
8 SASI_Rn02_00290964 predicted 546
9 SASI_Rn02_00290965 predicted 482
10 SASI_Rn02_00290966 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033795 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288994 predicted 1741
2 SASI_Mm02_00288995 predicted 1714
3 SASI_Mm01_00179636 predicted 1205
4 SASI_Mm02_00288996 predicted 1761
5 SASI_Mm02_00288997 predicted 1495
6 SASI_Mm01_00179637 predicted 1078
7 SASI_Mm01_00179640 predicted 1247
8 SASI_Mm01_00179641 predicted 902
9 SASI_Mm01_00179643 predicted 1229
10 SASI_Mm02_00288998 predicted 1272
11 SASI_Mm01_00179635 predicted 511
12 SASI_Mm01_00179638 predicted 1178
13 SASI_Mm01_00179639 predicted 753
14 SASI_Mm01_00179642 predicted 1017
15 SASI_Mm01_00179644 predicted 912
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033795
ZCCHC16 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033795.3-1830s21c1
Sequence:CCGGAGTTGCTGTGGCATCACATTACTCGAGTAATGTGATGCCACAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033795.3-1282s21c1
Sequence:CCGGTCCACAGGATGCTACTAATTTCTCGAGAAATTAGTAGCATCCTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033795.3-972s21c1
Sequence:CCGGCTTACTCAGGTGACCATATTCCTCGAGGAATATGGTCACCTGAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033795.3-1196s21c1
Sequence:CCGGCTTGAGTTGCAGCAATCATTTCTCGAGAAATGATTGCTGCAACTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033795.3-1051s21c1
Sequence:CCGGTTTGAGGGCTCTGGATATTTCCTCGAGGAAATATCCAGAGCCCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033795
ZCCHC16 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033795.3-1830s21c1
Sequence:CCGGAGTTGCTGTGGCATCACATTACTCGAGTAATGTGATGCCACAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033795.3-1282s21c1
Sequence:CCGGTCCACAGGATGCTACTAATTTCTCGAGAAATTAGTAGCATCCTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033795.3-972s21c1
Sequence:CCGGCTTACTCAGGTGACCATATTCCTCGAGGAATATGGTCACCTGAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033795.3-1196s21c1
Sequence:CCGGCTTGAGTTGCAGCAATCATTTCTCGAGAAATGATTGCTGCAACTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033795.3-1051s21c1
Sequence:CCGGTTTGAGGGCTCTGGATATTTCCTCGAGGAAATATCCAGAGCCCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033795
ZCCHC16 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033795.3-1830s21c1
Sequence:CCGGAGTTGCTGTGGCATCACATTACTCGAGTAATGTGATGCCACAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033795.3-1282s21c1
Sequence:CCGGTCCACAGGATGCTACTAATTTCTCGAGAAATTAGTAGCATCCTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033795.3-972s21c1
Sequence:CCGGCTTACTCAGGTGACCATATTCCTCGAGGAATATGGTCACCTGAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033795.3-1196s21c1
Sequence:CCGGCTTGAGTTGCAGCAATCATTTCTCGAGAAATGATTGCTGCAACTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033795.3-1051s21c1
Sequence:CCGGTTTGAGGGCTCTGGATATTTCCTCGAGGAAATATCCAGAGCCCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004308
ZCCHC16 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 16
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000140869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004308.1-1147s1c1
Sequence:CCGGGCTTCCTTGATCCAACACCAACTCGAGTTGGTGTTGGATCAAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004308.1-666s1c1
Sequence:CCGGCACTCAGGTGACTACCTACTTCTCGAGAAGTAGGTAGTCACCTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004308.1-1308s1c1
Sequence:CCGGCACAAGAGATTGCCTTGCCAACTCGAGTTGGCAAGGCAATCTCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004308.1-696s1c1
Sequence:CCGGCCAAATCTCTAATCCTGCAAACTCGAGTTTGCAGGATTAGAGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004308.1-1963s1c1
Sequence:CCGGCCTTCCATAGAGCTATATGTTCTCGAGAACATATAGCTCTATGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004308
ZCCHC16 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 16
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000140869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004308.1-1147s1c1
Sequence:CCGGGCTTCCTTGATCCAACACCAACTCGAGTTGGTGTTGGATCAAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004308.1-666s1c1
Sequence:CCGGCACTCAGGTGACTACCTACTTCTCGAGAAGTAGGTAGTCACCTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004308.1-1308s1c1
Sequence:CCGGCACAAGAGATTGCCTTGCCAACTCGAGTTGGCAAGGCAATCTCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004308.1-696s1c1
Sequence:CCGGCCAAATCTCTAATCCTGCAAACTCGAGTTTGCAGGATTAGAGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004308.1-1963s1c1
Sequence:CCGGCCTTCCATAGAGCTATATGTTCTCGAGAACATATAGCTCTATGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004308
ZCCHC16 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 16
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000140869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004308.1-1147s1c1
Sequence:CCGGGCTTCCTTGATCCAACACCAACTCGAGTTGGTGTTGGATCAAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004308.1-666s1c1
Sequence:CCGGCACTCAGGTGACTACCTACTTCTCGAGAAGTAGGTAGTCACCTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004308.1-1308s1c1
Sequence:CCGGCACAAGAGATTGCCTTGCCAACTCGAGTTGGCAAGGCAATCTCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004308.1-696s1c1
Sequence:CCGGCCAAATCTCTAATCCTGCAAACTCGAGTTTGCAGGATTAGAGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004308.1-1963s1c1
Sequence:CCGGCCTTCCATAGAGCTATATGTTCTCGAGAACATATAGCTCTATGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks