EMAIL THIS PAGE TO A FRIEND

ZCCHC17

zinc finger, CCHC domain containing 17

Synonyms: HSPC251 PS1D RP11-266K22.1 pNO40
UniProtKB ID: Q9NP64, D3DPN4, Q6PKH4, Q9NYG4, Q9P0M8
Gene ID:
Mouse(619605) zinc finger, CCHC domain containing 17
Rat(500555) zinc finger, CCHC domain containing 17
Zebrafish(393516) zinc finger, CCHC domain containing 17
domestic cat(101094033) zinc finger, CCHC domain containing 17
dog(478157) zinc finger, CCHC domain containing 17
chicken(404295) zinc finger, CCHC domain containing 17
domestic guinea pig(100734724) zinc finger, CCHC domain containing 17
naked mole-rat(101701503) zinc finger, CCHC domain containing 17
cow(538816) zinc finger, CCHC domain containing 17
sheep(101120056) zinc finger, CCHC domain containing 17
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153160 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153160 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153160 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016505 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016505 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016505 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016505 Rosetta Predictions human pricing
NM_001109267 Rosetta Predictions rat pricing
NM_153160 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178187 predicted 1206
2 SASI_Hs01_00178188 predicted 1222
3 SASI_Hs01_00178189 predicted 202
4 SASI_Hs01_00178190 predicted 275
5 SASI_Hs01_00178191 predicted 418
6 SASI_Hs01_00178192 predicted 1237
7 SASI_Hs02_00349576 predicted 1209
8 SASI_Hs01_00178194 predicted 1219
9 SASI_Hs01_00178195 predicted 431
10 SASI_Hs01_00178196 predicted 293
11 SASI_Hs01_00178193 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109267 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246734 predicted 1293
2 SASI_Rn02_00246735 predicted 1058
3 SASI_Rn02_00246736 predicted 333
4 SASI_Rn02_00246737 predicted 298
5 SASI_Rn02_00246738 predicted 212
6 SASI_Rn02_00246739 predicted 206
7 SASI_Rn02_00246740 predicted 1349
8 SASI_Rn02_00246741 predicted 380
9 SASI_Rn02_00246742 predicted 1306
10 SASI_Rn02_00246743 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153160 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343053 predicted 275
2 SASI_Mm01_00108872 predicted 285
3 SASI_Mm02_00343054 predicted 311
4 SASI_Mm01_00108874 predicted 419
5 SASI_Mm02_00343055 predicted 331
6 SASI_Mm01_00108879 predicted 379
7 SASI_Mm01_00108881 predicted 277
8 SASI_Mm02_00343056 predicted 327
9 SASI_Mm02_00343057 predicted 412
10 SASI_Mm02_00343058 predicted 426
11 SASI_Mm01_00108873 predicted 1338
12 SASI_Mm01_00108875 predicted 213
13 SASI_Mm01_00108876 predicted 1352
14 SASI_Mm01_00108877 predicted 1364
15 SASI_Mm01_00108878 predicted 1283
16 SASI_Mm01_00108880 predicted 1348
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153160
VALIDATED
ZCCHC17 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 17
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153160.2-552s1c1
Sequence:CCGGCCACTTTGCCAAGGACTGTTTCTCGAGAAACAGTCCTTGGCAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153160.2-426s1c1
Sequence:CCGGCGATCCCAACAACGTTGTCATCTCGAGATGACAACGTTGTTGGGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198221    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153160.2-1359s1c1
Sequence:CCGGCCATTTCAAGCCTCTGCTTAACTCGAGTTAAGCAGAGGCTTGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153160.2-301s1c1
Sequence:CCGGCCTTCTGAGATAGTAGATGTTCTCGAGAACATCTACTATCTCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153160.2-438s1c1
Sequence:CCGGCGTTGTCATTGAGCAAGAAGACTCGAGTCTTCTTGCTCAATGACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153160.2-822s1c1
Sequence:CCGGGAAGAAGAAGAAGCACAAGAACTCGAGTTCTTGTGCTTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176457    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153160.2-1454s1c1
Sequence:CCGGCGACTTACAGACTTAACACATCTCGAGATGTGTTAAGTCTGTAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153160.3-159s21c1
Sequence:CCGGTGCCTGCACTGTATACTATTTCTCGAGAAATAGTATACAGTGCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153160.3-420s21c1
Sequence:CCGGATCCCAACAACGTTGTCATTGCTCGAGCAATGACAACGTTGTTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153160.3-571s21c1
Sequence:CCGGGCCAGGTGGAACCAAGTATTCCTCGAGGAATACTTGGTTCCACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153160.3-271s21c1
Sequence:CCGGGTCGTCCTGTCGAGTGGATAACTCGAGTTATCCACTCGACAGGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153160.3-1058s21c1
Sequence:CCGGTGCGCTCAGTGTCTTCATTTCCTCGAGGAAATGAAGACACTGAGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153160
VALIDATED
ZCCHC17 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 17
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153160.2-552s1c1
Sequence:CCGGCCACTTTGCCAAGGACTGTTTCTCGAGAAACAGTCCTTGGCAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153160.2-426s1c1
Sequence:CCGGCGATCCCAACAACGTTGTCATCTCGAGATGACAACGTTGTTGGGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198221    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153160.2-1359s1c1
Sequence:CCGGCCATTTCAAGCCTCTGCTTAACTCGAGTTAAGCAGAGGCTTGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153160.2-301s1c1
Sequence:CCGGCCTTCTGAGATAGTAGATGTTCTCGAGAACATCTACTATCTCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153160.2-438s1c1
Sequence:CCGGCGTTGTCATTGAGCAAGAAGACTCGAGTCTTCTTGCTCAATGACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153160.2-822s1c1
Sequence:CCGGGAAGAAGAAGAAGCACAAGAACTCGAGTTCTTGTGCTTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176457    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153160.2-1454s1c1
Sequence:CCGGCGACTTACAGACTTAACACATCTCGAGATGTGTTAAGTCTGTAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153160.3-159s21c1
Sequence:CCGGTGCCTGCACTGTATACTATTTCTCGAGAAATAGTATACAGTGCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153160.3-420s21c1
Sequence:CCGGATCCCAACAACGTTGTCATTGCTCGAGCAATGACAACGTTGTTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153160.3-571s21c1
Sequence:CCGGGCCAGGTGGAACCAAGTATTCCTCGAGGAATACTTGGTTCCACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153160.3-271s21c1
Sequence:CCGGGTCGTCCTGTCGAGTGGATAACTCGAGTTATCCACTCGACAGGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153160.3-1058s21c1
Sequence:CCGGTGCGCTCAGTGTCTTCATTTCCTCGAGGAAATGAAGACACTGAGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153160
VALIDATED
ZCCHC17 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 17
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153160.2-552s1c1
Sequence:CCGGCCACTTTGCCAAGGACTGTTTCTCGAGAAACAGTCCTTGGCAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153160.2-426s1c1
Sequence:CCGGCGATCCCAACAACGTTGTCATCTCGAGATGACAACGTTGTTGGGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198221    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153160.2-1359s1c1
Sequence:CCGGCCATTTCAAGCCTCTGCTTAACTCGAGTTAAGCAGAGGCTTGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153160.2-301s1c1
Sequence:CCGGCCTTCTGAGATAGTAGATGTTCTCGAGAACATCTACTATCTCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153160.2-438s1c1
Sequence:CCGGCGTTGTCATTGAGCAAGAAGACTCGAGTCTTCTTGCTCAATGACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153160.2-822s1c1
Sequence:CCGGGAAGAAGAAGAAGCACAAGAACTCGAGTTCTTGTGCTTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176457    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153160.2-1454s1c1
Sequence:CCGGCGACTTACAGACTTAACACATCTCGAGATGTGTTAAGTCTGTAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153160.3-159s21c1
Sequence:CCGGTGCCTGCACTGTATACTATTTCTCGAGAAATAGTATACAGTGCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153160.3-420s21c1
Sequence:CCGGATCCCAACAACGTTGTCATTGCTCGAGCAATGACAACGTTGTTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153160.3-571s21c1
Sequence:CCGGGCCAGGTGGAACCAAGTATTCCTCGAGGAATACTTGGTTCCACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153160.3-271s21c1
Sequence:CCGGGTCGTCCTGTCGAGTGGATAACTCGAGTTATCCACTCGACAGGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153160.3-1058s21c1
Sequence:CCGGTGCGCTCAGTGTCTTCATTTCCTCGAGGAAATGAAGACACTGAGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016505
VALIDATED
ZCCHC17 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 17
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_016505.2-750s1c1
Sequence:CCGGGCTCAGACTCTGAGAGTGATACTCGAGTATCACTCTCAGAGTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_016505.2-312s1c1
Sequence:CCGGAGATAGTAGATGTTGGAGATACTCGAGTATCTCCAACATCTACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_016505.2-203s1c1
Sequence:CCGGGTTGCTATGGTGACAGACTATCTCGAGATAGTCTGTCACCATAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_016505.2-634s1c1
Sequence:CCGGAGAGGCAAAGTCAGCAGAGTTCTCGAGAACTCTGCTGACTTTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_016505.2-542s1c1
Sequence:CCGGTGTGGCTGTAAAGGCCACTTTCTCGAGAAAGTGGCCTTTACAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016505.2-257s21c1
Sequence:CCGGCAAGGTCTGGTCCATCGAACTCTCGAGAGTTCGATGGACCAGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016505.2-664s21c1
Sequence:CCGGTGACCCTACAAGGAATCCTTCCTCGAGGAAGGATTCCTTGTAGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016505.2-580s21c1
Sequence:CCGGGCAACCAGGTGGGACTAAATACTCGAGTATTTAGTCCCACCTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016505.2-1169s21c1
Sequence:CCGGCCAGAGCTGGATTCCTGTAAACTCGAGTTTACAGGAATCCAGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016505.2-431s21c1
Sequence:CCGGGATCCCAACAATGTTATCATTCTCGAGAATGATAACATTGTTGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016505.2-932s21c1
Sequence:CCGGAGACTCAATAGTGAGAATATACTCGAGTATATTCTCACTATTGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016505
VALIDATED
ZCCHC17 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 17
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_016505.2-750s1c1
Sequence:CCGGGCTCAGACTCTGAGAGTGATACTCGAGTATCACTCTCAGAGTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_016505.2-312s1c1
Sequence:CCGGAGATAGTAGATGTTGGAGATACTCGAGTATCTCCAACATCTACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_016505.2-203s1c1
Sequence:CCGGGTTGCTATGGTGACAGACTATCTCGAGATAGTCTGTCACCATAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_016505.2-634s1c1
Sequence:CCGGAGAGGCAAAGTCAGCAGAGTTCTCGAGAACTCTGCTGACTTTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_016505.2-542s1c1
Sequence:CCGGTGTGGCTGTAAAGGCCACTTTCTCGAGAAAGTGGCCTTTACAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016505.2-257s21c1
Sequence:CCGGCAAGGTCTGGTCCATCGAACTCTCGAGAGTTCGATGGACCAGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016505.2-664s21c1
Sequence:CCGGTGACCCTACAAGGAATCCTTCCTCGAGGAAGGATTCCTTGTAGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016505.2-580s21c1
Sequence:CCGGGCAACCAGGTGGGACTAAATACTCGAGTATTTAGTCCCACCTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016505.2-1169s21c1
Sequence:CCGGCCAGAGCTGGATTCCTGTAAACTCGAGTTTACAGGAATCCAGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016505.2-431s21c1
Sequence:CCGGGATCCCAACAATGTTATCATTCTCGAGAATGATAACATTGTTGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016505.2-932s21c1
Sequence:CCGGAGACTCAATAGTGAGAATATACTCGAGTATATTCTCACTATTGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016505
VALIDATED
ZCCHC17 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 17
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_016505.2-750s1c1
Sequence:CCGGGCTCAGACTCTGAGAGTGATACTCGAGTATCACTCTCAGAGTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_016505.2-312s1c1
Sequence:CCGGAGATAGTAGATGTTGGAGATACTCGAGTATCTCCAACATCTACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_016505.2-203s1c1
Sequence:CCGGGTTGCTATGGTGACAGACTATCTCGAGATAGTCTGTCACCATAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_016505.2-634s1c1
Sequence:CCGGAGAGGCAAAGTCAGCAGAGTTCTCGAGAACTCTGCTGACTTTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_016505.2-542s1c1
Sequence:CCGGTGTGGCTGTAAAGGCCACTTTCTCGAGAAAGTGGCCTTTACAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016505.2-257s21c1
Sequence:CCGGCAAGGTCTGGTCCATCGAACTCTCGAGAGTTCGATGGACCAGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016505.2-664s21c1
Sequence:CCGGTGACCCTACAAGGAATCCTTCCTCGAGGAAGGATTCCTTGTAGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016505.2-580s21c1
Sequence:CCGGGCAACCAGGTGGGACTAAATACTCGAGTATTTAGTCCCACCTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016505.2-1169s21c1
Sequence:CCGGCCAGAGCTGGATTCCTGTAAACTCGAGTTTACAGGAATCCAGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016505.2-431s21c1
Sequence:CCGGGATCCCAACAATGTTATCATTCTCGAGAATGATAACATTGTTGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016505.2-932s21c1
Sequence:CCGGAGACTCAATAGTGAGAATATACTCGAGTATATTCTCACTATTGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks