EMAIL THIS PAGE TO A FRIEND

ZCCHC18

zinc finger, CCHC domain containing 18

Synonyms: PNMA7B SIZN2
UniProtKB ID: P0CG32
Gene ID:
Mouse(66995) zinc finger, CCHC domain containing 18
Rat(679126) zinc finger, CCHC domain containing 18
cow(786510) zinc finger, CCHC domain containing 18
sheep(101122762) zinc finger, CCHC domain containing 18
naked mole-rat(101716447) zinc finger, CCHC domain containing 18
domestic guinea pig(100713380) zinc finger, CCHC domain containing 18
domestic cat(101082727) zinc finger, CCHC domain containing 18
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001143978 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001143978 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001143978 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025893 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025893 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025893 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU077781 MISSION® esiRNA esiRNA targeting mouse Zcchc18 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_016527 Rosetta Predictions human pricing
XR_018173 Rosetta Predictions human pricing
XR_039901 Rosetta Predictions human pricing
XM_001054389 Rosetta Predictions rat pricing
XM_001054444 Rosetta Predictions rat pricing
XM_001054498 Rosetta Predictions rat pricing
XM_001054555 Rosetta Predictions rat pricing
NM_001035509 Rosetta Predictions mouse pricing
NM_001035510 Rosetta Predictions mouse pricing
NM_025893 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_016527 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00491066 predicted 777
2 SASI_Hs02_00491067 predicted 1143
3 SASI_Hs02_00491068 predicted 903
4 SASI_Hs02_00491069 predicted 1083
5 SASI_Hs02_00491070 predicted 629
6 SASI_Hs02_00491071 predicted 1209
7 SASI_Hs02_00491072 predicted 628
8 SASI_Hs02_00491073 predicted 779
9 SASI_Hs02_00491074 predicted 573
10 SASI_Hs02_00491075 predicted 1220
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_018173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00495510 predicted 776
2 SASI_Hs02_00495511 predicted 1143
3 SASI_Hs02_00495512 predicted 911
4 SASI_Hs02_00495513 predicted 1075
5 SASI_Hs02_00495514 predicted 624
6 SASI_Hs02_00495515 predicted 1207
7 SASI_Hs02_00495516 predicted 626
8 SASI_Hs02_00495517 predicted 777
9 SASI_Hs02_00495518 predicted 571
10 SASI_Hs02_00495519 predicted 1222
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514073 predicted 774
2 SASI_Hs02_00514074 predicted 1148
3 SASI_Hs02_00514075 predicted 908
4 SASI_Hs02_00514076 predicted 1078
5 SASI_Hs02_00514077 predicted 627
6 SASI_Hs02_00514078 predicted 1207
7 SASI_Hs02_00514079 predicted 622
8 SASI_Hs02_00514080 predicted 773
9 SASI_Hs02_00514081 predicted 573
10 SASI_Hs02_00514082 predicted 1224
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054389 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275658 predicted 1772
2 SASI_Rn02_00275659 predicted 480
3 SASI_Rn02_00275660 predicted 1718
4 SASI_Rn02_00275661 predicted 1301
5 SASI_Rn02_00275662 predicted 835
6 SASI_Rn02_00275663 predicted 804
7 SASI_Rn02_00275664 predicted 1298
8 SASI_Rn02_00275665 predicted 471
9 SASI_Rn02_00275666 predicted 1772
10 SASI_Rn02_00275667 predicted 1080
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054444 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275795 predicted 1746
2 SASI_Rn02_00275796 predicted 452
3 SASI_Rn02_00275797 predicted 1683
4 SASI_Rn02_00275798 predicted 1267
5 SASI_Rn02_00275799 predicted 806
6 SASI_Rn02_00275800 predicted 783
7 SASI_Rn02_00275801 predicted 1265
8 SASI_Rn02_00275802 predicted 440
9 SASI_Rn02_00275803 predicted 1748
10 SASI_Rn02_00275804 predicted 1054
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054498 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276035 predicted 1810
2 SASI_Rn02_00276036 predicted 519
3 SASI_Rn02_00276037 predicted 1756
4 SASI_Rn02_00276038 predicted 1341
5 SASI_Rn02_00276039 predicted 869
6 SASI_Rn02_00276040 predicted 854
7 SASI_Rn02_00276041 predicted 1340
8 SASI_Rn02_00276042 predicted 508
9 SASI_Rn02_00276043 predicted 1821
10 SASI_Rn02_00276044 predicted 1117
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054555 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276253 predicted 1816
2 SASI_Rn02_00276254 predicted 515
3 SASI_Rn02_00276255 predicted 1750
4 SASI_Rn02_00276256 predicted 1338
5 SASI_Rn02_00276257 predicted 866
6 SASI_Rn02_00276258 predicted 851
7 SASI_Rn02_00276259 predicted 1339
8 SASI_Rn02_00276260 predicted 506
9 SASI_Rn02_00276261 predicted 1819
10 SASI_Rn02_00276262 predicted 1120
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035509 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200145 predicted 941
2 SASI_Mm01_00200146 predicted 1242
3 SASI_Mm01_00200147 predicted 793
4 SASI_Mm01_00200148 predicted 779
5 SASI_Mm01_00200149 predicted 1788
6 SASI_Mm01_00200150 predicted 683
7 SASI_Mm01_00200151 predicted 1642
8 SASI_Mm01_00200152 predicted 859
9 SASI_Mm01_00200153 predicted 1770
10 SASI_Mm01_00200154 predicted 1153
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157986 predicted 1416
2 SASI_Mm01_00157987 predicted 1711
3 SASI_Mm01_00157988 predicted 1261
4 SASI_Mm01_00157989 predicted 1253
5 SASI_Mm01_00157990 predicted 2254
6 SASI_Mm01_00157991 predicted 1156
7 SASI_Mm01_00157992 predicted 2121
8 SASI_Mm01_00157993 predicted 1331
9 SASI_Mm01_00157994 predicted 2238
10 SASI_Mm01_00157995 predicted 1625
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025893 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027593 predicted 895
2 SASI_Mm01_00027594 predicted 1184
3 SASI_Mm01_00027595 predicted 742
4 SASI_Mm01_00027596 predicted 731
5 SASI_Mm01_00027597 predicted 1730
6 SASI_Mm01_00027598 predicted 627
7 SASI_Mm01_00027599 predicted 1594
8 SASI_Mm01_00027600 predicted 808
9 SASI_Mm01_00027601 predicted 1722
10 SASI_Mm01_00027602 predicted 1101
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001143978
ZCCHC18 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 18
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143978.1-2349s21c1
Sequence:CCGGTACACAACCCGCTGTTCATATCTCGAGATATGAACAGCGGGTTGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001143978.1-2561s21c1
Sequence:CCGGTGTATTCAGAGTCTGGTAATGCTCGAGCATTACCAGACTCTGAATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143978.1-2227s21c1
Sequence:CCGGTGGATCAAGTGCTGGTTATTGCTCGAGCAATAACCAGCACTTGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143978.1-2095s21c1
Sequence:CCGGACTGTAACTGCAACGTGATAGCTCGAGCTATCACGTTGCAGTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143978.1-2308s21c1
Sequence:CCGGATGATGGTCCTGGGAATATTCCTCGAGGAATATTCCCAGGACCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001143978
ZCCHC18 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 18
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143978.1-2349s21c1
Sequence:CCGGTACACAACCCGCTGTTCATATCTCGAGATATGAACAGCGGGTTGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001143978.1-2561s21c1
Sequence:CCGGTGTATTCAGAGTCTGGTAATGCTCGAGCATTACCAGACTCTGAATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143978.1-2227s21c1
Sequence:CCGGTGGATCAAGTGCTGGTTATTGCTCGAGCAATAACCAGCACTTGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143978.1-2095s21c1
Sequence:CCGGACTGTAACTGCAACGTGATAGCTCGAGCTATCACGTTGCAGTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143978.1-2308s21c1
Sequence:CCGGATGATGGTCCTGGGAATATTCCTCGAGGAATATTCCCAGGACCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001143978
ZCCHC18 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 18
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143978.1-2349s21c1
Sequence:CCGGTACACAACCCGCTGTTCATATCTCGAGATATGAACAGCGGGTTGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001143978.1-2561s21c1
Sequence:CCGGTGTATTCAGAGTCTGGTAATGCTCGAGCATTACCAGACTCTGAATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143978.1-2227s21c1
Sequence:CCGGTGGATCAAGTGCTGGTTATTGCTCGAGCAATAACCAGCACTTGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143978.1-2095s21c1
Sequence:CCGGACTGTAACTGCAACGTGATAGCTCGAGCTATCACGTTGCAGTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143978.1-2308s21c1
Sequence:CCGGATGATGGTCCTGGGAATATTCCTCGAGGAATATTCCCAGGACCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025893
ZCCHC18 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 18
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025893.2-1425s1c1
Sequence:CCGGCAGGAAGAGATGCTGATTATTCTCGAGAATAATCAGCATCTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025893.2-825s1c1
Sequence:CCGGGCTGACAATCCCAATCTAAATCTCGAGATTTAGATTGGGATTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025893.2-1104s1c1
Sequence:CCGGCTCCAAATGCATGCGCATAATCTCGAGATTATGCGCATGCATTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025893.2-1425s21c1
Sequence:CCGGCAGGAAGAGATGCTGATTATTCTCGAGAATAATCAGCATCTCTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025893.2-2072s21c1
Sequence:CCGGTACCTGTGTGCCTCGGTATATCTCGAGATATACCGAGGCACACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025893.2-1287s21c1
Sequence:CCGGATAGGCAGTGCCGACTGTAATCTCGAGATTACAGTCGGCACTGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025893.2-1104s21c1
Sequence:CCGGCTCCAAATGCATGCGCATAATCTCGAGATTATGCGCATGCATTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025893.2-883s21c1
Sequence:CCGGGAGCGTCTGAGAGCAGTATAACTCGAGTTATACTGCTCTCAGACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025893.1-592s1c1
Sequence:CCGGCCTTGGTCCTTTGATTGCCAACTCGAGTTGGCAATCAAAGGACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025893.1-1275s1c1
Sequence:CCGGCCGACTGTAATGTGATAGAGACTCGAGTCTCTATCACATTACAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191761    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025893.1-1859s1c1
Sequence:CCGGGCTCATTCCATTAACTGCTTACTCGAGTAAGCAGTTAATGGAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025893
ZCCHC18 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 18
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025893.2-1425s1c1
Sequence:CCGGCAGGAAGAGATGCTGATTATTCTCGAGAATAATCAGCATCTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025893.2-825s1c1
Sequence:CCGGGCTGACAATCCCAATCTAAATCTCGAGATTTAGATTGGGATTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025893.2-1104s1c1
Sequence:CCGGCTCCAAATGCATGCGCATAATCTCGAGATTATGCGCATGCATTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025893.2-1425s21c1
Sequence:CCGGCAGGAAGAGATGCTGATTATTCTCGAGAATAATCAGCATCTCTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025893.2-2072s21c1
Sequence:CCGGTACCTGTGTGCCTCGGTATATCTCGAGATATACCGAGGCACACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025893.2-1287s21c1
Sequence:CCGGATAGGCAGTGCCGACTGTAATCTCGAGATTACAGTCGGCACTGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025893.2-1104s21c1
Sequence:CCGGCTCCAAATGCATGCGCATAATCTCGAGATTATGCGCATGCATTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025893.2-883s21c1
Sequence:CCGGGAGCGTCTGAGAGCAGTATAACTCGAGTTATACTGCTCTCAGACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025893.1-592s1c1
Sequence:CCGGCCTTGGTCCTTTGATTGCCAACTCGAGTTGGCAATCAAAGGACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025893.1-1275s1c1
Sequence:CCGGCCGACTGTAATGTGATAGAGACTCGAGTCTCTATCACATTACAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191761    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025893.1-1859s1c1
Sequence:CCGGGCTCATTCCATTAACTGCTTACTCGAGTAAGCAGTTAATGGAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025893
ZCCHC18 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 18
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025893.2-1425s1c1
Sequence:CCGGCAGGAAGAGATGCTGATTATTCTCGAGAATAATCAGCATCTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025893.2-825s1c1
Sequence:CCGGGCTGACAATCCCAATCTAAATCTCGAGATTTAGATTGGGATTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025893.2-1104s1c1
Sequence:CCGGCTCCAAATGCATGCGCATAATCTCGAGATTATGCGCATGCATTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025893.2-1425s21c1
Sequence:CCGGCAGGAAGAGATGCTGATTATTCTCGAGAATAATCAGCATCTCTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025893.2-2072s21c1
Sequence:CCGGTACCTGTGTGCCTCGGTATATCTCGAGATATACCGAGGCACACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025893.2-1287s21c1
Sequence:CCGGATAGGCAGTGCCGACTGTAATCTCGAGATTACAGTCGGCACTGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025893.2-1104s21c1
Sequence:CCGGCTCCAAATGCATGCGCATAATCTCGAGATTATGCGCATGCATTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025893.2-883s21c1
Sequence:CCGGGAGCGTCTGAGAGCAGTATAACTCGAGTTATACTGCTCTCAGACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025893.1-592s1c1
Sequence:CCGGCCTTGGTCCTTTGATTGCCAACTCGAGTTGGCAATCAAAGGACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025893.1-1275s1c1
Sequence:CCGGCCGACTGTAATGTGATAGAGACTCGAGTCTCTATCACATTACAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191761    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025893.1-1859s1c1
Sequence:CCGGGCTCATTCCATTAACTGCTTACTCGAGTAAGCAGTTAATGGAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks