EMAIL THIS PAGE TO A FRIEND

ZCCHC24

zinc finger, CCHC domain containing 24

Synonyms: C10orf56
UniProtKB ID: Q8N2G6, Q5U5T9, Q8TAG0
Gene ID:
Mouse(71918) zinc finger, CCHC domain containing 24
Rat(361104) zinc finger, CCHC domain containing 24
Zebrafish(562028) zinc finger, CCHC domain containing 24
chicken(423722) zinc finger, CCHC domain containing 24
domestic cat(101099837) zinc finger, CCHC domain containing 24
dog(610507) zinc finger, CCHC domain containing 24
cow(616669) zinc finger, CCHC domain containing 24
sheep(101111771) zinc finger, CCHC domain containing 24
naked mole-rat(101709481) zinc finger, CCHC domain containing 24
domestic guinea pig(100728898) zinc finger, CCHC domain containing 24
174 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153367 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153367 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153367 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001101433 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001101433 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001101433 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153367 Rosetta Predictions human pricing
NM_001108394 Rosetta Predictions rat pricing
NM_001101433 Rosetta Predictions mouse pricing
XM_975187 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134619 predicted 1335
2 SASI_Hs01_00134620 predicted 466
3 SASI_Hs01_00134621 predicted 1363
4 SASI_Hs01_00134622 predicted 383
5 SASI_Hs01_00134623 predicted 654
6 SASI_Hs01_00134624 predicted 1341
7 SASI_Hs01_00134625 predicted 689
8 SASI_Hs01_00134626 predicted 570
9 SASI_Hs01_00134627 predicted 1327
10 SASI_Hs01_00134628 predicted 1246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108394 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238229 predicted 963
2 SASI_Rn02_00238230 predicted 293
3 SASI_Rn02_00238231 predicted 1189
4 SASI_Rn02_00238232 predicted 515
5 SASI_Rn02_00238233 predicted 208
6 SASI_Rn02_00238234 predicted 823
7 SASI_Rn02_00238235 predicted 299
8 SASI_Rn02_00238236 predicted 911
9 SASI_Rn02_00238237 predicted 214
10 SASI_Rn02_00238238 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101433 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302349 predicted 1111
2 SASI_Mm02_00302350 predicted 1182
3 SASI_Mm02_00302351 predicted 778
4 SASI_Mm02_00302352 predicted 1103
5 SASI_Mm02_00302353 predicted 848
6 SASI_Mm02_00302354 predicted 764
7 SASI_Mm02_00302355 predicted 1111
8 SASI_Mm02_00302356 predicted 205
9 SASI_Mm02_00302357 predicted 1067
10 SASI_Mm02_00302358 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975187 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00282236 predicted 1125
2 SASI_Mm01_00282237 predicted 1193
3 SASI_Mm01_00282238 predicted 786
4 SASI_Mm01_00282239 predicted 1115
5 SASI_Mm01_00282240 predicted 863
6 SASI_Mm01_00282241 predicted 201
7 SASI_Mm01_00282242 predicted 776
8 SASI_Mm01_00282243 predicted 1121
9 SASI_Mm01_00282244 predicted 211
10 SASI_Mm01_00282245 predicted 1036
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153367
VALIDATED
ZCCHC24 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 24
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_153367.3-466s21c1
Sequence:CCGGACCCTATGGCTCCCTCAACAACTCGAGTTGTTGAGGGAGCCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_153367.3-690s21c1
Sequence:CCGGGCGAGTACAAGTGTCCCAAGTCTCGAGACTTGGGACACTTGTACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153367.3-385s21c1
Sequence:CCGGCCTGCACTCCAGCTATCTCAACTCGAGTTGAGATAGCTGGAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153367.3-1261s21c1
Sequence:CCGGTTGGCCACAGGTGCACTAAATCTCGAGATTTAGTGCACCTGTGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_153367.3-768s21c1
Sequence:CCGGAGTGCCACATCAACGTGTATCCTCGAGGATACACGTTGATGTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153367.1-599s1c1
Sequence:CCGGGCTTCAACAAAGGACACTACACTCGAGTGTAGTGTCCTTTGTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153367.1-396s1c1
Sequence:CCGGCAGCTATCTCAACAGCTTCTTCTCGAGAAGAAGCTGTTGAGATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153367.1-777s1c1
Sequence:CCGGCATCAACGTGTATCCACACAACTCGAGTTGTGTGGATACACGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153367.1-603s1c1
Sequence:CCGGCAACAAAGGACACTACATCAACTCGAGTTGATGTAGTGTCCTTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153367
VALIDATED
ZCCHC24 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 24
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_153367.3-466s21c1
Sequence:CCGGACCCTATGGCTCCCTCAACAACTCGAGTTGTTGAGGGAGCCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_153367.3-690s21c1
Sequence:CCGGGCGAGTACAAGTGTCCCAAGTCTCGAGACTTGGGACACTTGTACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153367.3-385s21c1
Sequence:CCGGCCTGCACTCCAGCTATCTCAACTCGAGTTGAGATAGCTGGAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153367.3-1261s21c1
Sequence:CCGGTTGGCCACAGGTGCACTAAATCTCGAGATTTAGTGCACCTGTGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_153367.3-768s21c1
Sequence:CCGGAGTGCCACATCAACGTGTATCCTCGAGGATACACGTTGATGTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153367.1-599s1c1
Sequence:CCGGGCTTCAACAAAGGACACTACACTCGAGTGTAGTGTCCTTTGTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153367.1-396s1c1
Sequence:CCGGCAGCTATCTCAACAGCTTCTTCTCGAGAAGAAGCTGTTGAGATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153367.1-777s1c1
Sequence:CCGGCATCAACGTGTATCCACACAACTCGAGTTGTGTGGATACACGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153367.1-603s1c1
Sequence:CCGGCAACAAAGGACACTACATCAACTCGAGTTGATGTAGTGTCCTTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153367
VALIDATED
ZCCHC24 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 24
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_153367.3-466s21c1
Sequence:CCGGACCCTATGGCTCCCTCAACAACTCGAGTTGTTGAGGGAGCCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_153367.3-690s21c1
Sequence:CCGGGCGAGTACAAGTGTCCCAAGTCTCGAGACTTGGGACACTTGTACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153367.3-385s21c1
Sequence:CCGGCCTGCACTCCAGCTATCTCAACTCGAGTTGAGATAGCTGGAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153367.3-1261s21c1
Sequence:CCGGTTGGCCACAGGTGCACTAAATCTCGAGATTTAGTGCACCTGTGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_153367.3-768s21c1
Sequence:CCGGAGTGCCACATCAACGTGTATCCTCGAGGATACACGTTGATGTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153367.1-599s1c1
Sequence:CCGGGCTTCAACAAAGGACACTACACTCGAGTGTAGTGTCCTTTGTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153367.1-396s1c1
Sequence:CCGGCAGCTATCTCAACAGCTTCTTCTCGAGAAGAAGCTGTTGAGATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153367.1-777s1c1
Sequence:CCGGCATCAACGTGTATCCACACAACTCGAGTTGTGTGGATACACGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153367.1-603s1c1
Sequence:CCGGCAACAAAGGACACTACATCAACTCGAGTTGATGTAGTGTCCTTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101433
ZCCHC24 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 24
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101433.1-494s21c1
Sequence:CCGGGCTGCTTTGGCGAGTACAAGTCTCGAGACTTGTACTCGCCAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101433.1-2287s21c1
Sequence:CCGGAGCTAGCTGCAGGGTAGATTTCTCGAGAAATCTACCCTGCAGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101433.1-394s21c1
Sequence:CCGGTACCTGTGCCACCTGTGTTTCCTCGAGGAAACACAGGTGGCACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101433.1-198s21c1
Sequence:CCGGCCTGCACTCCAGTTATCTTAACTCGAGTTAAGATAACTGGAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101433.1-279s21c1
Sequence:CCGGGCCCTACGGTTCCCTCAATAACTCGAGTTATTGAGGGAACCGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101433
ZCCHC24 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 24
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101433.1-494s21c1
Sequence:CCGGGCTGCTTTGGCGAGTACAAGTCTCGAGACTTGTACTCGCCAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101433.1-2287s21c1
Sequence:CCGGAGCTAGCTGCAGGGTAGATTTCTCGAGAAATCTACCCTGCAGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101433.1-394s21c1
Sequence:CCGGTACCTGTGCCACCTGTGTTTCCTCGAGGAAACACAGGTGGCACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101433.1-198s21c1
Sequence:CCGGCCTGCACTCCAGTTATCTTAACTCGAGTTAAGATAACTGGAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101433.1-279s21c1
Sequence:CCGGGCCCTACGGTTCCCTCAATAACTCGAGTTATTGAGGGAACCGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101433
ZCCHC24 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 24
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101433.1-494s21c1
Sequence:CCGGGCTGCTTTGGCGAGTACAAGTCTCGAGACTTGTACTCGCCAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101433.1-2287s21c1
Sequence:CCGGAGCTAGCTGCAGGGTAGATTTCTCGAGAAATCTACCCTGCAGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101433.1-394s21c1
Sequence:CCGGTACCTGTGCCACCTGTGTTTCCTCGAGGAAACACAGGTGGCACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101433.1-198s21c1
Sequence:CCGGCCTGCACTCCAGTTATCTTAACTCGAGTTAAGATAACTGGAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101433.1-279s21c1
Sequence:CCGGGCCCTACGGTTCCCTCAATAACTCGAGTTATTGAGGGAACCGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks