EMAIL THIS PAGE TO A FRIEND

ZCCHC2

zinc finger, CCHC domain containing 2

Synonyms: C18orf49
UniProtKB ID: Q9C0B9, Q8N3S1, Q9NXF6
Gene ID:
Mouse(227449) zinc finger, CCHC domain containing 2
Rat(304695) zinc finger, CCHC domain containing 2
chicken(420905) zinc finger, CCHC domain containing 2
dog(476180) zinc finger, CCHC domain containing 2
domestic cat(101090902) zinc finger, CCHC domain containing 2
Horse(100056858) zinc finger, CCHC domain containing 2
domestic guinea pig(100723840) zinc finger, CCHC domain containing 2
naked mole-rat(101700477) zinc finger, CCHC domain containing 2
Domestic Rabbit(100358526) zinc finger, CCHC domain containing 2
cow(787099) zinc finger, CCHC domain containing 2
sheep(101119100) zinc finger, CCHC domain containing 2
192 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017742 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017742 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017742 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001122675 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001122675 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001122675 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052061 MISSION® esiRNA esiRNA human ZCCHC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017742 Rosetta Predictions human pricing
NM_001122677 Rosetta Predictions rat pricing
NM_001122675 Rosetta Predictions mouse pricing
NM_001122676 Rosetta Predictions mouse pricing
XM_129972 Rosetta Predictions mouse pricing
XM_900114 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017742 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350542 predicted 1007
2 SASI_Hs01_00233462 predicted 1246
3 SASI_Hs01_00233464 predicted 2678
4 SASI_Hs01_00233463 predicted 1899
5 SASI_Hs02_00350543 predicted 1880
6 SASI_Hs02_00350544 predicted 1097
7 SASI_Hs01_00233467 predicted 3465
8 SASI_Hs01_00233468 predicted 3546
9 SASI_Hs01_00233469 predicted 2400
10 SASI_Hs01_00233470 predicted 3501
11 SASI_Hs01_00233461 predicted 1139
12 SASI_Hs01_00233465 predicted 760
13 SASI_Hs01_00233466 predicted 2600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122677 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252683 predicted 2569
2 SASI_Rn02_00252684 predicted 1460
3 SASI_Rn02_00252685 predicted 1303
4 SASI_Rn02_00252686 predicted 3900
5 SASI_Rn02_00252687 predicted 1921
6 SASI_Rn02_00252688 predicted 1334
7 SASI_Rn02_00252689 predicted 1732
8 SASI_Rn02_00252690 predicted 3818
9 SASI_Rn02_00252691 predicted 3675
10 SASI_Rn02_00252692 predicted 3853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122675 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309202 predicted 2341
2 SASI_Mm02_00309203 predicted 2697
3 SASI_Mm02_00309204 predicted 2130
4 SASI_Mm02_00309205 predicted 2560
5 SASI_Mm02_00309206 predicted 1916
6 SASI_Mm02_00309207 predicted 1609
7 SASI_Mm02_00309208 predicted 2779
8 SASI_Mm02_00309209 predicted 1461
9 SASI_Mm02_00309210 predicted 1330
10 SASI_Mm02_00309211 predicted 2794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122676 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309212 predicted 2333
2 SASI_Mm02_00309213 predicted 2699
3 SASI_Mm02_00309214 predicted 2126
4 SASI_Mm02_00309215 predicted 2560
5 SASI_Mm02_00309216 predicted 1914
6 SASI_Mm02_00309217 predicted 1605
7 SASI_Mm02_00309218 predicted 2775
8 SASI_Mm02_00309219 predicted 1453
9 SASI_Mm02_00309220 predicted 1330
10 SASI_Mm02_00309221 predicted 2789
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129972 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259351 predicted 2345
2 SASI_Mm01_00259352 predicted 2703
3 SASI_Mm01_00259353 predicted 2569
4 SASI_Mm01_00259354 predicted 1917
5 SASI_Mm01_00259355 predicted 1620
6 SASI_Mm01_00259356 predicted 2789
7 SASI_Mm01_00259357 predicted 3669
8 SASI_Mm01_00259358 predicted 1458
9 SASI_Mm01_00259359 predicted 2251
10 SASI_Mm01_00259360 predicted 1337
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900114 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229007 predicted 883
2 SASI_Mm01_00229008 predicted 898
3 SASI_Mm01_00229009 predicted 1239
4 SASI_Mm01_00229010 predicted 674
5 SASI_Mm01_00229011 predicted 1096
6 SASI_Mm01_00229012 predicted 1321
7 SASI_Mm01_00229013 predicted 1307
8 SASI_Mm01_00229014 predicted 2213
9 SASI_Mm01_00229015 predicted 778
10 SASI_Mm01_00229016 predicted 2481
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017742
VALIDATED
ZCCHC2 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017742.3-3146s1c1
Sequence:CCGGCCCTGATCTTATGGGAGGAATCTCGAGATTCCTCCCATAAGATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017742.3-1477s1c1
Sequence:CCGGCCCGCTTTGCATCTTACAGTTCTCGAGAACTGTAAGATGCAAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017742.3-2566s1c1
Sequence:CCGGCCTTCTAATGATACGTTGGATCTCGAGATCCAACGTATCATTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017742.3-456s1c1
Sequence:CCGGCCTACACAGTATCAATAACTTCTCGAGAAGTTATTGATACTGTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017742.3-1744s1c1
Sequence:CCGGCCTACCAATGTGAAGGTAGTTCTCGAGAACTACCTTCACATTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_017742.4-2130s21c1
Sequence:CCGGACCCAAGTATCAGCATATTTCCTCGAGGAAATATGCTGATACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240883    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_017742.4-5335s21c1
Sequence:CCGGTGTACTTTATGGAGCTTATTTCTCGAGAAATAAGCTCCATAAAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_017742.4-3527s21c1
Sequence:CCGGCTGCAGACTGAAACGAGTAAACTCGAGTTTACTCGTTTCAGTCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_017742.4-1495s21c1
Sequence:CCGGGTGTTGCAGCATGCCATAATCCTCGAGGATTATGGCATGCTGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017742.4-2006s21c1
Sequence:CCGGATCCATCAACAACTAGGTTTACTCGAGTAAACCTAGTTGTTGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017742
VALIDATED
ZCCHC2 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017742.3-3146s1c1
Sequence:CCGGCCCTGATCTTATGGGAGGAATCTCGAGATTCCTCCCATAAGATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017742.3-1477s1c1
Sequence:CCGGCCCGCTTTGCATCTTACAGTTCTCGAGAACTGTAAGATGCAAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017742.3-2566s1c1
Sequence:CCGGCCTTCTAATGATACGTTGGATCTCGAGATCCAACGTATCATTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017742.3-456s1c1
Sequence:CCGGCCTACACAGTATCAATAACTTCTCGAGAAGTTATTGATACTGTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017742.3-1744s1c1
Sequence:CCGGCCTACCAATGTGAAGGTAGTTCTCGAGAACTACCTTCACATTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_017742.4-2130s21c1
Sequence:CCGGACCCAAGTATCAGCATATTTCCTCGAGGAAATATGCTGATACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240883    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_017742.4-5335s21c1
Sequence:CCGGTGTACTTTATGGAGCTTATTTCTCGAGAAATAAGCTCCATAAAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_017742.4-3527s21c1
Sequence:CCGGCTGCAGACTGAAACGAGTAAACTCGAGTTTACTCGTTTCAGTCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_017742.4-1495s21c1
Sequence:CCGGGTGTTGCAGCATGCCATAATCCTCGAGGATTATGGCATGCTGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017742.4-2006s21c1
Sequence:CCGGATCCATCAACAACTAGGTTTACTCGAGTAAACCTAGTTGTTGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017742
VALIDATED
ZCCHC2 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017742.3-3146s1c1
Sequence:CCGGCCCTGATCTTATGGGAGGAATCTCGAGATTCCTCCCATAAGATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017742.3-1477s1c1
Sequence:CCGGCCCGCTTTGCATCTTACAGTTCTCGAGAACTGTAAGATGCAAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017742.3-2566s1c1
Sequence:CCGGCCTTCTAATGATACGTTGGATCTCGAGATCCAACGTATCATTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017742.3-456s1c1
Sequence:CCGGCCTACACAGTATCAATAACTTCTCGAGAAGTTATTGATACTGTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017742.3-1744s1c1
Sequence:CCGGCCTACCAATGTGAAGGTAGTTCTCGAGAACTACCTTCACATTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_017742.4-2130s21c1
Sequence:CCGGACCCAAGTATCAGCATATTTCCTCGAGGAAATATGCTGATACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240883    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_017742.4-5335s21c1
Sequence:CCGGTGTACTTTATGGAGCTTATTTCTCGAGAAATAAGCTCCATAAAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_017742.4-3527s21c1
Sequence:CCGGCTGCAGACTGAAACGAGTAAACTCGAGTTTACTCGTTTCAGTCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_017742.4-1495s21c1
Sequence:CCGGGTGTTGCAGCATGCCATAATCCTCGAGGATTATGGCATGCTGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017742.4-2006s21c1
Sequence:CCGGATCCATCAACAACTAGGTTTACTCGAGTAAACCTAGTTGTTGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001122675
VALIDATED
ZCCHC2 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122675.1-2616s21c1
Sequence:CCGGCCCTAATGCGGTGGCTATTTCCTCGAGGAAATAGCCACCGCATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001122675.1-2975s21c1
Sequence:CCGGCCCAAGTGGTAGGACTAAATCCTCGAGGATTTAGTCCTACCACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001122675.1-5882s21c1
Sequence:CCGGTAAATCGCTTCCAGGTAATTTCTCGAGAAATTACCTGGAAGCGATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001122675.1-1308s21c1
Sequence:CCGGCTCTGCCTGTGGTGACTATATCTCGAGATATAGTCACCACAGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001122675.1-3428s21c1
Sequence:CCGGTCCAGCTAAATAGTTACTATTCTCGAGAATAGTAACTATTTAGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001122675
VALIDATED
ZCCHC2 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122675.1-2616s21c1
Sequence:CCGGCCCTAATGCGGTGGCTATTTCCTCGAGGAAATAGCCACCGCATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001122675.1-2975s21c1
Sequence:CCGGCCCAAGTGGTAGGACTAAATCCTCGAGGATTTAGTCCTACCACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001122675.1-5882s21c1
Sequence:CCGGTAAATCGCTTCCAGGTAATTTCTCGAGAAATTACCTGGAAGCGATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001122675.1-1308s21c1
Sequence:CCGGCTCTGCCTGTGGTGACTATATCTCGAGATATAGTCACCACAGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001122675.1-3428s21c1
Sequence:CCGGTCCAGCTAAATAGTTACTATTCTCGAGAATAGTAACTATTTAGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001122675
VALIDATED
ZCCHC2 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122675.1-2616s21c1
Sequence:CCGGCCCTAATGCGGTGGCTATTTCCTCGAGGAAATAGCCACCGCATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001122675.1-2975s21c1
Sequence:CCGGCCCAAGTGGTAGGACTAAATCCTCGAGGATTTAGTCCTACCACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001122675.1-5882s21c1
Sequence:CCGGTAAATCGCTTCCAGGTAATTTCTCGAGAAATTACCTGGAAGCGATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001122675.1-1308s21c1
Sequence:CCGGCTCTGCCTGTGGTGACTATATCTCGAGATATAGTCACCACAGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001122675.1-3428s21c1
Sequence:CCGGTCCAGCTAAATAGTTACTATTCTCGAGAATAGTAACTATTTAGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks