EMAIL THIS PAGE TO A FRIEND

ZCCHC3

zinc finger, CCHC domain containing 3

Synonyms: C20orf99
UniProtKB ID: Q9NUD5, Q6NT79
Gene ID:
Mouse(67917) zinc finger, CCHC domain containing 3
Rat(690005) zinc finger, CCHC domain containing 3
domestic guinea pig(100728735) zinc finger, CCHC domain containing 3
naked mole-rat(101719899) zinc finger, CCHC domain containing 3
cow(507116) zinc finger, CCHC domain containing 3
sheep(101108507) zinc finger, CCHC domain containing 3
domestic cat(101090004) zinc finger, CCHC domain containing 3
dog(100687075) zinc finger, CCHC domain containing 3
169 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033089 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033089 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033089 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175126 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175126 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175126 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033089 Rosetta Predictions human pricing
XM_001072887 Rosetta Predictions rat pricing
NM_175126 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209316 predicted 504
2 SASI_Hs01_00209318 predicted 566
3 SASI_Hs01_00209323 predicted 525
4 SASI_Hs01_00209319 predicted 688
5 SASI_Hs01_00209320 predicted 648
6 SASI_Hs01_00209321 predicted 760
7 SASI_Hs01_00209317 predicted 823
8 SASI_Hs01_00209322 predicted 1389
9 SASI_Hs02_00360795 predicted 679
10 SASI_Hs01_00209324 predicted 1135
11 SASI_Hs01_00209325 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072887 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340793 predicted 1128
2 SASI_Rn02_00340794 predicted 1044
3 SASI_Rn02_00340795 predicted 1080
4 SASI_Rn02_00340796 predicted 919
5 SASI_Rn02_00340797 predicted 613
6 SASI_Rn02_00340798 predicted 212
7 SASI_Rn02_00340799 predicted 1011
8 SASI_Rn02_00340800 predicted 325
9 SASI_Rn02_00340801 predicted 826
10 SASI_Rn02_00340802 predicted 1370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175126 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039725 predicted 1033
2 SASI_Mm01_00039727 predicted 831
3 SASI_Mm01_00039728 predicted 867
4 SASI_Mm02_00345739 predicted 907
5 SASI_Mm01_00039729 predicted 525
6 SASI_Mm01_00039730 predicted 914
7 SASI_Mm02_00345740 predicted 747
8 SASI_Mm01_00039732 predicted 800
9 SASI_Mm01_00039733 predicted 719
10 SASI_Mm01_00039734 predicted 1263
11 SASI_Mm01_00039726 predicted 558
12 SASI_Mm01_00039731 predicted 738
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033089
ZCCHC3 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033089.4-1007s1c1
Sequence:CCGGGCAGCCCAAGACATGCTTTAACTCGAGTTAAAGCATGTCTTGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033089.4-1171s1c1
Sequence:CCGGGTCCCAAAGCAGTGCACAATTCTCGAGAATTGTGCACTGCTTTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033089.4-767s1c1
Sequence:CCGGCAGCTTGAAGACGCTCTTCATCTCGAGATGAAGAGCGTCTTCAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033089.4-149s1c1
Sequence:CCGGGAAGAATCTAGCCGAGAAGAACTCGAGTTCTTCTCGGCTAGATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033089.4-608s1c1
Sequence:CCGGGAGCGACATCTACGCGGTCATCTCGAGATGACCGCGTAGATGTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033089.6-1366s21c1
Sequence:CCGGTGCCTTCTTAAACCGAGTTTACTCGAGTAAACTCGGTTTAAGAAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033089.6-1425s21c1
Sequence:CCGGCAATAACGACTGCGGAGAACTCTCGAGAGTTCTCCGCAGTCGTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033089.6-1258s21c1
Sequence:CCGGTGAACACACAGCCAGCTTATCCTCGAGGATAAGCTGGCTGTGTGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033089
ZCCHC3 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033089.4-1007s1c1
Sequence:CCGGGCAGCCCAAGACATGCTTTAACTCGAGTTAAAGCATGTCTTGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033089.4-1171s1c1
Sequence:CCGGGTCCCAAAGCAGTGCACAATTCTCGAGAATTGTGCACTGCTTTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033089.4-767s1c1
Sequence:CCGGCAGCTTGAAGACGCTCTTCATCTCGAGATGAAGAGCGTCTTCAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033089.4-149s1c1
Sequence:CCGGGAAGAATCTAGCCGAGAAGAACTCGAGTTCTTCTCGGCTAGATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033089.4-608s1c1
Sequence:CCGGGAGCGACATCTACGCGGTCATCTCGAGATGACCGCGTAGATGTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033089.6-1366s21c1
Sequence:CCGGTGCCTTCTTAAACCGAGTTTACTCGAGTAAACTCGGTTTAAGAAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033089.6-1425s21c1
Sequence:CCGGCAATAACGACTGCGGAGAACTCTCGAGAGTTCTCCGCAGTCGTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033089.6-1258s21c1
Sequence:CCGGTGAACACACAGCCAGCTTATCCTCGAGGATAAGCTGGCTGTGTGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033089
ZCCHC3 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033089.4-1007s1c1
Sequence:CCGGGCAGCCCAAGACATGCTTTAACTCGAGTTAAAGCATGTCTTGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033089.4-1171s1c1
Sequence:CCGGGTCCCAAAGCAGTGCACAATTCTCGAGAATTGTGCACTGCTTTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033089.4-767s1c1
Sequence:CCGGCAGCTTGAAGACGCTCTTCATCTCGAGATGAAGAGCGTCTTCAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033089.4-149s1c1
Sequence:CCGGGAAGAATCTAGCCGAGAAGAACTCGAGTTCTTCTCGGCTAGATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033089.4-608s1c1
Sequence:CCGGGAGCGACATCTACGCGGTCATCTCGAGATGACCGCGTAGATGTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033089.6-1366s21c1
Sequence:CCGGTGCCTTCTTAAACCGAGTTTACTCGAGTAAACTCGGTTTAAGAAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033089.6-1425s21c1
Sequence:CCGGCAATAACGACTGCGGAGAACTCTCGAGAGTTCTCCGCAGTCGTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033089.6-1258s21c1
Sequence:CCGGTGAACACACAGCCAGCTTATCCTCGAGGATAAGCTGGCTGTGTGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175126
ZCCHC3 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175126.3-1403s1c1
Sequence:CCGGGCAGTTCACAATTCCGTGACACTCGAGTGTCACGGAATTGTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175126.3-868s1c1
Sequence:CCGGCCGCGAGTTCGACGTGAGTTTCTCGAGAAACTCACGTCGAACTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175126.3-1090s1c1
Sequence:CCGGCGTGAAAGTGACCGACAGGTTCTCGAGAACCTGTCGGTCACTTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175126.3-1231s1c1
Sequence:CCGGGCAGCCCAAGACGTGCTTTAACTCGAGTTAAAGCACGTCTTGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175126.3-833s1c1
Sequence:CCGGGACGACATCTACGCGGTCATTCTCGAGAATGACCGCGTAGATGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175126.4-851s21c1
Sequence:CCGGACGACATCTACGCGGTCATTCCTCGAGGAATGACCGCGTAGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175126.4-965s21c1
Sequence:CCGGAGGACTGCTGGGAGAACTTTGCTCGAGCAAAGTTCTCCCAGCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175126.4-1412s21c1
Sequence:CCGGGTCCCAAAGCAGTTCACAATTCTCGAGAATTGTGAACTGCTTTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175126.4-1249s21c1
Sequence:CCGGCAGCCCAAGACGTGCTTTAAGCTCGAGCTTAAAGCACGTCTTGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175126.4-1684s21c1
Sequence:CCGGACCATTGCATACAGATATATTCTCGAGAATATATCTGTATGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175126
ZCCHC3 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175126.3-1403s1c1
Sequence:CCGGGCAGTTCACAATTCCGTGACACTCGAGTGTCACGGAATTGTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175126.3-868s1c1
Sequence:CCGGCCGCGAGTTCGACGTGAGTTTCTCGAGAAACTCACGTCGAACTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175126.3-1090s1c1
Sequence:CCGGCGTGAAAGTGACCGACAGGTTCTCGAGAACCTGTCGGTCACTTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175126.3-1231s1c1
Sequence:CCGGGCAGCCCAAGACGTGCTTTAACTCGAGTTAAAGCACGTCTTGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175126.3-833s1c1
Sequence:CCGGGACGACATCTACGCGGTCATTCTCGAGAATGACCGCGTAGATGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175126.4-851s21c1
Sequence:CCGGACGACATCTACGCGGTCATTCCTCGAGGAATGACCGCGTAGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175126.4-965s21c1
Sequence:CCGGAGGACTGCTGGGAGAACTTTGCTCGAGCAAAGTTCTCCCAGCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175126.4-1412s21c1
Sequence:CCGGGTCCCAAAGCAGTTCACAATTCTCGAGAATTGTGAACTGCTTTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175126.4-1249s21c1
Sequence:CCGGCAGCCCAAGACGTGCTTTAAGCTCGAGCTTAAAGCACGTCTTGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175126.4-1684s21c1
Sequence:CCGGACCATTGCATACAGATATATTCTCGAGAATATATCTGTATGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175126
ZCCHC3 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175126.3-1403s1c1
Sequence:CCGGGCAGTTCACAATTCCGTGACACTCGAGTGTCACGGAATTGTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175126.3-868s1c1
Sequence:CCGGCCGCGAGTTCGACGTGAGTTTCTCGAGAAACTCACGTCGAACTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175126.3-1090s1c1
Sequence:CCGGCGTGAAAGTGACCGACAGGTTCTCGAGAACCTGTCGGTCACTTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175126.3-1231s1c1
Sequence:CCGGGCAGCCCAAGACGTGCTTTAACTCGAGTTAAAGCACGTCTTGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175126.3-833s1c1
Sequence:CCGGGACGACATCTACGCGGTCATTCTCGAGAATGACCGCGTAGATGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175126.4-851s21c1
Sequence:CCGGACGACATCTACGCGGTCATTCCTCGAGGAATGACCGCGTAGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175126.4-965s21c1
Sequence:CCGGAGGACTGCTGGGAGAACTTTGCTCGAGCAAAGTTCTCCCAGCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175126.4-1412s21c1
Sequence:CCGGGTCCCAAAGCAGTTCACAATTCTCGAGAATTGTGAACTGCTTTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175126.4-1249s21c1
Sequence:CCGGCAGCCCAAGACGTGCTTTAAGCTCGAGCTTAAAGCACGTCTTGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175126.4-1684s21c1
Sequence:CCGGACCATTGCATACAGATATATTCTCGAGAATATATCTGTATGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks