EMAIL THIS PAGE TO A FRIEND

ZCCHC4

zinc finger, CCHC domain containing 4

Synonyms: HSPC052
UniProtKB ID: Q9H5U6, B2RXF6, B4DRD8, B7ZW20, Q5IW78, Q96AN7
Gene ID:
Mouse(78796) zinc finger, CCHC domain containing 4
Rat(360946) zinc finger, CCHC domain containing 4
chicken(422806) zinc finger, CCHC domain containing 4
Horse(100067435) zinc finger, CCHC domain containing 4
domestic cat(101080533) zinc finger, CCHC domain containing 4
dog(479125) zinc finger, CCHC domain containing 4
cow(511397) zinc finger, CCHC domain containing 4
sheep(101105658) zinc finger, CCHC domain containing 4
naked mole-rat(101699806) zinc finger, CCHC domain containing 4
Domestic Rabbit(100345736) zinc finger, CCHC domain containing 4
domestic guinea pig(100717640) zinc finger, CCHC domain containing 4
197 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030185 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030185 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030185 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024936 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024936 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024936 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024936 Rosetta Predictions human pricing
XM_376310 Rosetta Predictions human pricing
XM_933301 Rosetta Predictions human pricing
XM_933306 Rosetta Predictions human pricing
XM_933315 Rosetta Predictions human pricing
NM_001108360 Rosetta Predictions rat pricing
NM_030185 Rosetta Predictions mouse pricing
XM_132052 Rosetta Predictions mouse pricing
XM_892492 Rosetta Predictions mouse pricing
XM_900128 Rosetta Predictions mouse pricing
XM_900140 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357564 predicted 1397
2 SASI_Hs02_00357565 predicted 668
3 SASI_Hs02_00357566 predicted 470
4 SASI_Hs02_00357567 predicted 1561
5 SASI_Hs02_00357568 predicted 585
6 SASI_Hs02_00357569 predicted 489
7 SASI_Hs02_00357570 predicted 354
8 SASI_Hs02_00357571 predicted 506
9 SASI_Hs02_00357572 predicted 1492
10 SASI_Hs02_00357573 predicted 1353
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_376310 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00297508 predicted 1398
2 SASI_Hs01_00297509 predicted 671
3 SASI_Hs01_00297510 predicted 472
4 SASI_Hs01_00297511 predicted 1560
5 SASI_Hs01_00297512 predicted 589
6 SASI_Hs01_00297513 predicted 492
7 SASI_Hs01_00297514 predicted 1403
8 SASI_Hs01_00297515 predicted 1543
9 SASI_Hs01_00297516 predicted 498
10 SASI_Hs01_00297517 predicted 1497
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933301 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281462 predicted 224
2 SASI_Hs01_00281463 predicted 663
3 SASI_Hs01_00281464 predicted 471
4 SASI_Hs01_00281465 predicted 1202
5 SASI_Hs01_00281466 predicted 1105
6 SASI_Hs01_00281467 predicted 582
7 SASI_Hs01_00281468 predicted 1177
8 SASI_Hs01_00281469 predicted 494
9 SASI_Hs01_00281470 predicted 353
10 SASI_Hs01_00281471 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933306 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258509 predicted 224
2 SASI_Hs01_00258510 predicted 672
3 SASI_Hs01_00258511 predicted 466
4 SASI_Hs01_00258512 predicted 580
5 SASI_Hs01_00258513 predicted 487
6 SASI_Hs01_00258514 predicted 357
7 SASI_Hs01_00258515 predicted 502
8 SASI_Hs01_00258516 predicted 1400
9 SASI_Hs01_00258517 predicted 594
10 SASI_Hs01_00258518 predicted 1418
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933315 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259726 predicted 345
2 SASI_Hs01_00259727 predicted 218
3 SASI_Hs01_00259728 predicted 669
4 SASI_Hs01_00259729 predicted 582
5 SASI_Hs01_00259730 predicted 493
6 SASI_Hs01_00259731 predicted 378
7 SASI_Hs01_00259732 predicted 538
8 SASI_Hs01_00259733 predicted 504
9 SASI_Hs01_00259734 predicted 451
10 SASI_Hs01_00259735 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108360 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237899 predicted 824
2 SASI_Rn02_00237900 predicted 1101
3 SASI_Rn02_00237901 predicted 1304
4 SASI_Rn02_00237902 predicted 1092
5 SASI_Rn02_00237903 predicted 1528
6 SASI_Rn02_00237904 predicted 1176
7 SASI_Rn02_00237905 predicted 1452
8 SASI_Rn02_00237906 predicted 1174
9 SASI_Rn02_00237907 predicted 1564
10 SASI_Rn02_00237908 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030185 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336604 predicted 743
2 SASI_Mm02_00336605 predicted 1550
3 SASI_Mm02_00336606 predicted 632
4 SASI_Mm02_00336607 predicted 637
5 SASI_Mm02_00336608 predicted 1409
6 SASI_Mm02_00336609 predicted 373
7 SASI_Mm02_00336610 predicted 754
8 SASI_Mm02_00336611 predicted 1015
9 SASI_Mm02_00336612 predicted 1464
10 SASI_Mm02_00336613 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132052 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253968 predicted 759
2 SASI_Mm01_00253969 predicted 1249
3 SASI_Mm01_00253970 predicted 644
4 SASI_Mm01_00253971 predicted 662
5 SASI_Mm01_00253972 predicted 390
6 SASI_Mm01_00253973 predicted 1031
7 SASI_Mm01_00253974 predicted 1589
8 SASI_Mm01_00253975 predicted 430
9 SASI_Mm01_00253976 predicted 478
10 SASI_Mm01_00253977 predicted 1354
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_892492 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209679 predicted 758
2 SASI_Mm01_00209680 predicted 1251
3 SASI_Mm01_00209681 predicted 1565
4 SASI_Mm01_00209682 predicted 648
5 SASI_Mm01_00209683 predicted 659
6 SASI_Mm01_00209684 predicted 1435
7 SASI_Mm01_00209685 predicted 395
8 SASI_Mm01_00209686 predicted 1028
9 SASI_Mm01_00209687 predicted 425
10 SASI_Mm01_00209688 predicted 477
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900128 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276497 predicted 716
2 SASI_Mm01_00276498 predicted 737
3 SASI_Mm01_00276499 predicted 951
4 SASI_Mm01_00276500 predicted 704
5 SASI_Mm01_00276501 predicted 817
6 SASI_Mm01_00276502 predicted 999
7 SASI_Mm01_00276503 predicted 661
8 SASI_Mm01_00276504 predicted 918
9 SASI_Mm01_00276505 predicted 936
10 SASI_Mm01_00276506 predicted 972
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900140 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225491 predicted 210
2 SASI_Mm01_00225492 predicted 214
3 SASI_Mm01_00225493 predicted 209
4 SASI_Mm01_00225494 predicted 205
5 SASI_Mm01_00225495 predicted 147
6 SASI_Mm01_00225496 predicted 30
7 SASI_Mm01_00225497 predicted 335
8 SASI_Mm01_00225498 predicted 279
9 SASI_Mm01_00225499 predicted 333
10 SASI_Mm01_00225500 predicted 33
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030185
VALIDATED
ZCCHC4 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030185.2-1619s21c1
Sequence:CCGGAGTCCTGCCTTGACAGCTTTCCTCGAGGAAAGCTGTCAAGGCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030185.2-279s21c1
Sequence:CCGGTAGACTTGCTGCCCGAGAAATCTCGAGATTTCTCGGGCAGCAAGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030185.2-903s21c1
Sequence:CCGGTATGTGGAAAGAAGGTCAAAGCTCGAGCTTTGACCTTCTTTCCACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030185.2-1019s21c1
Sequence:CCGGTGGATTACCAGGTGGATTATGCTCGAGCATAATCCACCTGGTAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030185.2-864s21c1
Sequence:CCGGGGTGGAACCTCTGGCTATTACCTCGAGGTAATAGCCAGAGGTTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030185
VALIDATED
ZCCHC4 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030185.2-1619s21c1
Sequence:CCGGAGTCCTGCCTTGACAGCTTTCCTCGAGGAAAGCTGTCAAGGCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030185.2-279s21c1
Sequence:CCGGTAGACTTGCTGCCCGAGAAATCTCGAGATTTCTCGGGCAGCAAGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030185.2-903s21c1
Sequence:CCGGTATGTGGAAAGAAGGTCAAAGCTCGAGCTTTGACCTTCTTTCCACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030185.2-1019s21c1
Sequence:CCGGTGGATTACCAGGTGGATTATGCTCGAGCATAATCCACCTGGTAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030185.2-864s21c1
Sequence:CCGGGGTGGAACCTCTGGCTATTACCTCGAGGTAATAGCCAGAGGTTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030185
VALIDATED
ZCCHC4 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030185.2-1619s21c1
Sequence:CCGGAGTCCTGCCTTGACAGCTTTCCTCGAGGAAAGCTGTCAAGGCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030185.2-279s21c1
Sequence:CCGGTAGACTTGCTGCCCGAGAAATCTCGAGATTTCTCGGGCAGCAAGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030185.2-903s21c1
Sequence:CCGGTATGTGGAAAGAAGGTCAAAGCTCGAGCTTTGACCTTCTTTCCACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030185.2-1019s21c1
Sequence:CCGGTGGATTACCAGGTGGATTATGCTCGAGCATAATCCACCTGGTAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030185.2-864s21c1
Sequence:CCGGGGTGGAACCTCTGGCTATTACCTCGAGGTAATAGCCAGAGGTTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024936
ZCCHC4 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024936.2-2477s21c1
Sequence:CCGGTGACGGTCTAGAATCACTTAACTCGAGTTAAGTGATTCTAGACCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024936.2-1378s21c1
Sequence:GTACCGGTGTGGTGAACTGGATCATAAACTCGAGTTTATGATCCAGTTCACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024936.2-579s21c1
Sequence:GTACCGGGTTCTTGGTAGACTTACTTTCCTCGAGGAAAGTAAGTCTACCAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024936.2-1400s21c1
Sequence:CCGGGCAGTACTTGTCCTAACATTGCTCGAGCAATGTTAGGACAAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024936.2-882s21c1
Sequence:CCGGGGTTGAACCTCTGGCTATTACCTCGAGGTAATAGCCAGAGGTTCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024936
ZCCHC4 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024936.2-2477s21c1
Sequence:CCGGTGACGGTCTAGAATCACTTAACTCGAGTTAAGTGATTCTAGACCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024936.2-1378s21c1
Sequence:GTACCGGTGTGGTGAACTGGATCATAAACTCGAGTTTATGATCCAGTTCACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024936.2-579s21c1
Sequence:GTACCGGGTTCTTGGTAGACTTACTTTCCTCGAGGAAAGTAAGTCTACCAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024936.2-1400s21c1
Sequence:CCGGGCAGTACTTGTCCTAACATTGCTCGAGCAATGTTAGGACAAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024936.2-882s21c1
Sequence:CCGGGGTTGAACCTCTGGCTATTACCTCGAGGTAATAGCCAGAGGTTCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024936
ZCCHC4 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024936.2-2477s21c1
Sequence:CCGGTGACGGTCTAGAATCACTTAACTCGAGTTAAGTGATTCTAGACCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024936.2-1378s21c1
Sequence:GTACCGGTGTGGTGAACTGGATCATAAACTCGAGTTTATGATCCAGTTCACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024936.2-579s21c1
Sequence:GTACCGGGTTCTTGGTAGACTTACTTTCCTCGAGGAAAGTAAGTCTACCAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024936.2-1400s21c1
Sequence:CCGGGCAGTACTTGTCCTAACATTGCTCGAGCAATGTTAGGACAAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024936.2-882s21c1
Sequence:CCGGGGTTGAACCTCTGGCTATTACCTCGAGGTAATAGCCAGAGGTTCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks