EMAIL THIS PAGE TO A FRIEND

ZCCHC5

zinc finger, CCHC domain containing 5

Synonyms: Mar3 Mart3 ZHC5
UniProtKB ID: Q8N8U3, B2RMZ0, Q5JQE9
Gene ID:
Human(203430) Summary: This gene is a member of a family of gag-related retrotransposon genes. These genes appear to have lost the ability to retrotranspose; however, their open reading frames have remained intact, which may indicate that these genes have acquired new functions in the cell. [provided by RefSeq, Nov 2009]
Mouse(213436) zinc finger, CCHC domain containing 5
Rat(317221) zinc finger, CCHC domain containing 5
cow(506964) zinc finger, CCHC domain containing 5
sheep(101106496) zinc finger, CCHC domain containing 5
domestic cat(101089173) zinc finger, CCHC domain containing 5
dog(100683734) zinc finger, CCHC domain containing 5
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152694 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152694 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152694 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199468 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199468 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199468 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152694 Rosetta Predictions human pricing
XM_001059107 Rosetta Predictions rat pricing
XM_228502 Rosetta Predictions rat pricing
NM_199468 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152694 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224304 predicted 1119
2 SASI_Hs01_00224305 predicted 1561
3 SASI_Hs02_00366583 predicted 1796
4 SASI_Hs02_00366584 predicted 929
5 SASI_Hs01_00224307 predicted 1066
6 SASI_Hs01_00224308 predicted 1630
7 SASI_Hs01_00224309 predicted 1767
8 SASI_Hs01_00224310 predicted 300
9 SASI_Hs02_00366585 predicted 1008
10 SASI_Hs01_00224312 predicted 430
11 SASI_Hs01_00224303 predicted 1176
12 SASI_Hs01_00224306 predicted 1167
13 SASI_Hs01_00224311 predicted 1208
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059107 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291984 predicted 1253
2 SASI_Rn02_00291985 predicted 974
3 SASI_Rn02_00291986 predicted 1830
4 SASI_Rn02_00291987 predicted 1073
5 SASI_Rn02_00291988 predicted 1259
6 SASI_Rn02_00291989 predicted 1171
7 SASI_Rn02_00291990 predicted 1339
8 SASI_Rn02_00291991 predicted 1352
9 SASI_Rn02_00291992 predicted 1453
10 SASI_Rn02_00291993 predicted 1574
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228502 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385162 predicted 260
2 SASI_Rn02_00385163 predicted 255
3 SASI_Rn02_00385164 predicted 254
4 SASI_Rn02_00385165 predicted 259
5 SASI_Rn02_00385166 predicted 290
6 SASI_Rn02_00385167 predicted 261
7 SASI_Rn02_00385168 predicted 285
8 SASI_Rn02_00385169 predicted 205
9 SASI_Rn02_00385170 predicted 257
10 SASI_Rn02_00385171 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199468 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113948 predicted 1187
2 SASI_Mm01_00113949 predicted 1460
3 SASI_Mm01_00113950 predicted 1981
4 SASI_Mm02_00351475 predicted 1282
5 SASI_Mm01_00113951 predicted 1741
6 SASI_Mm01_00113952 predicted 1547
7 SASI_Mm01_00113954 predicted 487
8 SASI_Mm01_00113955 predicted 1422
9 SASI_Mm01_00113956 predicted 1363
10 SASI_Mm01_00113957 predicted 1646
11 SASI_Mm01_00113953 predicted 477
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152694
ZCCHC5 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152694.2-2030s21c1
Sequence:CCGGGAGCTCCAGTTTGACATTATTCTCGAGAATAATGTCAAACTGGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152694.2-2134s21c1
Sequence:CCGGGTCCTTTCTATCACGTTATTGCTCGAGCAATAACGTGATAGAAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152694.2-1359s21c1
Sequence:CCGGAGCACTCTCTGGATCCAATTTCTCGAGAAATTGGATCCAGAGAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152694.1-2066s1c1
Sequence:CCGGCCTCTGATTATTGGAATCCATCTCGAGATGGATTCCAATAATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152694.1-1006s1c1
Sequence:CCGGCCCTGCAATACACTTTAACCTCTCGAGAGGTTAAAGTGTATTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152694.1-931s1c1
Sequence:CCGGGTCTAATAGTTGTGGAGACATCTCGAGATGTCTCCACAACTATTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152694.1-1392s1c1
Sequence:CCGGGCCAGTTCTATACAAGATGAACTCGAGTTCATCTTGTATAGAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152694.1-1007s1c1
Sequence:CCGGCCTGCAATACACTTTAACCTTCTCGAGAAGGTTAAAGTGTATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152694
ZCCHC5 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152694.2-2030s21c1
Sequence:CCGGGAGCTCCAGTTTGACATTATTCTCGAGAATAATGTCAAACTGGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152694.2-2134s21c1
Sequence:CCGGGTCCTTTCTATCACGTTATTGCTCGAGCAATAACGTGATAGAAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152694.2-1359s21c1
Sequence:CCGGAGCACTCTCTGGATCCAATTTCTCGAGAAATTGGATCCAGAGAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152694.1-2066s1c1
Sequence:CCGGCCTCTGATTATTGGAATCCATCTCGAGATGGATTCCAATAATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152694.1-1006s1c1
Sequence:CCGGCCCTGCAATACACTTTAACCTCTCGAGAGGTTAAAGTGTATTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152694.1-931s1c1
Sequence:CCGGGTCTAATAGTTGTGGAGACATCTCGAGATGTCTCCACAACTATTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152694.1-1392s1c1
Sequence:CCGGGCCAGTTCTATACAAGATGAACTCGAGTTCATCTTGTATAGAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152694.1-1007s1c1
Sequence:CCGGCCTGCAATACACTTTAACCTTCTCGAGAAGGTTAAAGTGTATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152694
ZCCHC5 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152694.2-2030s21c1
Sequence:CCGGGAGCTCCAGTTTGACATTATTCTCGAGAATAATGTCAAACTGGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152694.2-2134s21c1
Sequence:CCGGGTCCTTTCTATCACGTTATTGCTCGAGCAATAACGTGATAGAAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152694.2-1359s21c1
Sequence:CCGGAGCACTCTCTGGATCCAATTTCTCGAGAAATTGGATCCAGAGAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152694.1-2066s1c1
Sequence:CCGGCCTCTGATTATTGGAATCCATCTCGAGATGGATTCCAATAATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152694.1-1006s1c1
Sequence:CCGGCCCTGCAATACACTTTAACCTCTCGAGAGGTTAAAGTGTATTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152694.1-931s1c1
Sequence:CCGGGTCTAATAGTTGTGGAGACATCTCGAGATGTCTCCACAACTATTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152694.1-1392s1c1
Sequence:CCGGGCCAGTTCTATACAAGATGAACTCGAGTTCATCTTGTATAGAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152694.1-1007s1c1
Sequence:CCGGCCTGCAATACACTTTAACCTTCTCGAGAAGGTTAAAGTGTATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199468
ZCCHC5 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199468.1-1282s1c1
Sequence:CCGGCCCAGTGTGAATTAGAGGCTACTCGAGTAGCCTCTAATTCACACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199468.1-1634s1c1
Sequence:CCGGCCATCTCATTGCGCAAGAGTTCTCGAGAACTCTTGCGCAATGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177636    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199468.1-2457s1c1
Sequence:CCGGCGCATTACTGTCATTACAATTCTCGAGAATTGTAATGACAGTAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199468.1-402s1c1
Sequence:CCGGGTTACTCTGAAATTGGAGAATCTCGAGATTCTCCAATTTCAGAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199468.1-1741s1c1
Sequence:CCGGCCACCAACCTATCTGATGTGACTCGAGTCACATCAGATAGGTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199468
ZCCHC5 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199468.1-1282s1c1
Sequence:CCGGCCCAGTGTGAATTAGAGGCTACTCGAGTAGCCTCTAATTCACACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199468.1-1634s1c1
Sequence:CCGGCCATCTCATTGCGCAAGAGTTCTCGAGAACTCTTGCGCAATGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177636    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199468.1-2457s1c1
Sequence:CCGGCGCATTACTGTCATTACAATTCTCGAGAATTGTAATGACAGTAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199468.1-402s1c1
Sequence:CCGGGTTACTCTGAAATTGGAGAATCTCGAGATTCTCCAATTTCAGAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199468.1-1741s1c1
Sequence:CCGGCCACCAACCTATCTGATGTGACTCGAGTCACATCAGATAGGTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199468
ZCCHC5 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199468.1-1282s1c1
Sequence:CCGGCCCAGTGTGAATTAGAGGCTACTCGAGTAGCCTCTAATTCACACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199468.1-1634s1c1
Sequence:CCGGCCATCTCATTGCGCAAGAGTTCTCGAGAACTCTTGCGCAATGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177636    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199468.1-2457s1c1
Sequence:CCGGCGCATTACTGTCATTACAATTCTCGAGAATTGTAATGACAGTAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199468.1-402s1c1
Sequence:CCGGGTTACTCTGAAATTGGAGAATCTCGAGATTCTCCAATTTCAGAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199468.1-1741s1c1
Sequence:CCGGCCACCAACCTATCTGATGTGACTCGAGTCACATCAGATAGGTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks