EMAIL THIS PAGE TO A FRIEND

ZCCHC6

zinc finger, CCHC domain containing 6

Synonyms: PAPD6
Gene ID:
Mouse(214290) zinc finger, CCHC domain containing 6
Rat(501515) zinc finger, CCHC domain containing 6
chicken(100857368) zinc finger, CCHC domain containing 6
dog(476301) zinc finger, CCHC domain containing 6
domestic cat(101084065) zinc finger, CCHC domain containing 6
Horse(100061600) zinc finger, CCHC domain containing 6
cow(513209) zinc finger, CCHC domain containing 6
sheep(101114240) zinc finger, CCHC domain containing 6
domestic guinea pig(100725764) zinc finger, CCHC domain containing 6
naked mole-rat(101726471) zinc finger, CCHC domain containing 6
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153538 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153538 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153538 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024617 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024617 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024617 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024617 Rosetta Predictions human pricing
XM_001060307 Rosetta Predictions rat pricing
XM_001066334 Rosetta Predictions rat pricing
NM_153538 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356991 predicted 3586
2 SASI_Hs01_00040509 predicted 4243
3 SASI_Hs01_00040510 predicted 522
4 SASI_Hs02_00356992 predicted 2031
5 SASI_Hs01_00040512 predicted 3912
6 SASI_Hs01_00040513 predicted 3699
7 SASI_Hs01_00040514 predicted 1995
8 SASI_Hs01_00040515 predicted 536
9 SASI_Hs02_00356993 predicted 230
10 SASI_Hs02_00356994 predicted 2403
11 SASI_Hs01_00040507 predicted 506
12 SASI_Hs01_00040508 predicted 1210
13 SASI_Hs01_00040511 predicted 3304
14 SASI_Hs01_00040516 predicted 1671
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060307 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295993 predicted 1198
2 SASI_Rn02_00295994 predicted 1453
3 SASI_Rn02_00295995 predicted 1701
4 SASI_Rn02_00295996 predicted 1219
5 SASI_Rn02_00295997 predicted 3126
6 SASI_Rn02_00295998 predicted 2277
7 SASI_Rn02_00295999 predicted 3359
8 SASI_Rn02_00296000 predicted 3755
9 SASI_Rn02_00296001 predicted 4272
10 SASI_Rn02_00296002 predicted 2895
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066334 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317065 predicted 1195
2 SASI_Rn02_00317066 predicted 1453
3 SASI_Rn02_00317067 predicted 1696
4 SASI_Rn02_00317068 predicted 1219
5 SASI_Rn02_00317069 predicted 3126
6 SASI_Rn02_00317070 predicted 2282
7 SASI_Rn02_00317071 predicted 3359
8 SASI_Rn02_00317072 predicted 3755
9 SASI_Rn02_00317073 predicted 4271
10 SASI_Rn02_00317074 predicted 2890
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153538 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176680 predicted 1276
2 SASI_Mm01_00176681 predicted 1503
3 SASI_Mm02_00343302 predicted 1046
4 SASI_Mm01_00176682 predicted 2331
5 SASI_Mm01_00176684 predicted 207
6 SASI_Mm01_00176685 predicted 3152
7 SASI_Mm01_00176686 predicted 993
8 SASI_Mm01_00176688 predicted 2922
9 SASI_Mm02_00343303 predicted 4215
10 SASI_Mm02_00343304 predicted 958
11 SASI_Mm01_00176683 predicted 1523
12 SASI_Mm01_00176687 predicted 2094
13 SASI_Mm01_00176689 predicted 391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153538
VALIDATED
ZCCHC6 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 6
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125859    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153538.2-5069s1c1
Sequence:CCGGGTAGAAATGATAGCATGGAATCTCGAGATTCCATGCTATCATTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153538.2-1260s1c1
Sequence:CCGGGCGGCCTTCTTTGTAAAGTAACTCGAGTTACTTTACAAAGAAGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153538.2-86s1c1
Sequence:CCGGCGCACTAAAGACCGTGGAATTCTCGAGAATTCCACGGTCTTTAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153538.2-3054s1c1
Sequence:CCGGGCGTCCAGTGTTACAAGGATTCTCGAGAATCCTTGTAACACTGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153538.2-3421s1c1
Sequence:CCGGGCTTCATAACACAAGGCTCTTCTCGAGAAGAGCCTTGTGTTATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153538.2-4068s21c1
Sequence:CCGGATGACAGGTGCTGCCGAATTTCTCGAGAAATTCGGCAGCACCTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153538.3-1932s21c1
Sequence:CCGGCAGCCTGTGTTTGAGTATATACTCGAGTATATACTCAAACACAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153538.2-2871s21c1
Sequence:CCGGCTGAGTTCTTCTACGAATTTACTCGAGTAAATTCGTAGAAGAACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153538.2-3217s21c1
Sequence:CCGGTGACGTCTGTATGACGATTAACTCGAGTTAATCGTCATACAGACGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153538.2-1260s21c1
Sequence:CCGGGCGGCCTTCTTTGTAAAGTAACTCGAGTTACTTTACAAAGAAGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153538.2-4524s21c1
Sequence:CCGGGGTAGCCTTTCCAGTAAATATCTCGAGATATTTACTGGAAAGGCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153538.3-3264s21c1
Sequence:CCGGGACGTCTGTATGACGATTAACCTCGAGGTTAATCGTCATACAGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153538
VALIDATED
ZCCHC6 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 6
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125859    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153538.2-5069s1c1
Sequence:CCGGGTAGAAATGATAGCATGGAATCTCGAGATTCCATGCTATCATTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153538.2-1260s1c1
Sequence:CCGGGCGGCCTTCTTTGTAAAGTAACTCGAGTTACTTTACAAAGAAGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153538.2-86s1c1
Sequence:CCGGCGCACTAAAGACCGTGGAATTCTCGAGAATTCCACGGTCTTTAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153538.2-3054s1c1
Sequence:CCGGGCGTCCAGTGTTACAAGGATTCTCGAGAATCCTTGTAACACTGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153538.2-3421s1c1
Sequence:CCGGGCTTCATAACACAAGGCTCTTCTCGAGAAGAGCCTTGTGTTATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153538.2-4068s21c1
Sequence:CCGGATGACAGGTGCTGCCGAATTTCTCGAGAAATTCGGCAGCACCTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153538.3-1932s21c1
Sequence:CCGGCAGCCTGTGTTTGAGTATATACTCGAGTATATACTCAAACACAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153538.2-2871s21c1
Sequence:CCGGCTGAGTTCTTCTACGAATTTACTCGAGTAAATTCGTAGAAGAACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153538.2-3217s21c1
Sequence:CCGGTGACGTCTGTATGACGATTAACTCGAGTTAATCGTCATACAGACGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153538.2-1260s21c1
Sequence:CCGGGCGGCCTTCTTTGTAAAGTAACTCGAGTTACTTTACAAAGAAGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153538.2-4524s21c1
Sequence:CCGGGGTAGCCTTTCCAGTAAATATCTCGAGATATTTACTGGAAAGGCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153538.3-3264s21c1
Sequence:CCGGGACGTCTGTATGACGATTAACCTCGAGGTTAATCGTCATACAGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153538
VALIDATED
ZCCHC6 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 6
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125859    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153538.2-5069s1c1
Sequence:CCGGGTAGAAATGATAGCATGGAATCTCGAGATTCCATGCTATCATTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153538.2-1260s1c1
Sequence:CCGGGCGGCCTTCTTTGTAAAGTAACTCGAGTTACTTTACAAAGAAGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153538.2-86s1c1
Sequence:CCGGCGCACTAAAGACCGTGGAATTCTCGAGAATTCCACGGTCTTTAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153538.2-3054s1c1
Sequence:CCGGGCGTCCAGTGTTACAAGGATTCTCGAGAATCCTTGTAACACTGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153538.2-3421s1c1
Sequence:CCGGGCTTCATAACACAAGGCTCTTCTCGAGAAGAGCCTTGTGTTATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153538.2-4068s21c1
Sequence:CCGGATGACAGGTGCTGCCGAATTTCTCGAGAAATTCGGCAGCACCTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153538.3-1932s21c1
Sequence:CCGGCAGCCTGTGTTTGAGTATATACTCGAGTATATACTCAAACACAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153538.2-2871s21c1
Sequence:CCGGCTGAGTTCTTCTACGAATTTACTCGAGTAAATTCGTAGAAGAACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153538.2-3217s21c1
Sequence:CCGGTGACGTCTGTATGACGATTAACTCGAGTTAATCGTCATACAGACGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153538.2-1260s21c1
Sequence:CCGGGCGGCCTTCTTTGTAAAGTAACTCGAGTTACTTTACAAAGAAGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153538.2-4524s21c1
Sequence:CCGGGGTAGCCTTTCCAGTAAATATCTCGAGATATTTACTGGAAAGGCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153538.3-3264s21c1
Sequence:CCGGGACGTCTGTATGACGATTAACCTCGAGGTTAATCGTCATACAGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024617
VALIDATED
ZCCHC6 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024617.2-5467s1c1
Sequence:CCGGGCTGAAGATCAAAGAGGTTATCTCGAGATAACCTCTTTGATCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024617.2-3712s1c1
Sequence:CCGGGCAGCTTATCATCGTATGCATCTCGAGATGCATACGATGATAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024617.2-4979s1c1
Sequence:CCGGCGGTATTCAGTGAATACAGTTCTCGAGAACTGTATTCACTGAATACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_024617.2-1794s1c1
Sequence:CCGGCCAAGAGAAACGCCGATTAAACTCGAGTTTAATCGGCGTTTCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_024617.2-5467s21c1
Sequence:CCGGGCTGAAGATCAAAGAGGTTATCTCGAGATAACCTCTTTGATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_024617.2-3734s21c1
Sequence:CCGGTACTCTTATGGTGCTATATTTCTCGAGAAATATAGCACCATAAGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_024617.2-1794s21c1
Sequence:CCGGCCAAGAGAAACGCCGATTAAACTCGAGTTTAATCGGCGTTTCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_024617.2-2790s21c1
Sequence:CCGGGAACCTAGGCTCACCATTAACCTCGAGGTTAATGGTGAGCCTAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_024617.2-3119s21c1
Sequence:CCGGCAAACGAGAGGGTCATCTAAACTCGAGTTTAGATGACCCTCTCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024617
VALIDATED
ZCCHC6 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024617.2-5467s1c1
Sequence:CCGGGCTGAAGATCAAAGAGGTTATCTCGAGATAACCTCTTTGATCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024617.2-3712s1c1
Sequence:CCGGGCAGCTTATCATCGTATGCATCTCGAGATGCATACGATGATAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024617.2-4979s1c1
Sequence:CCGGCGGTATTCAGTGAATACAGTTCTCGAGAACTGTATTCACTGAATACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_024617.2-1794s1c1
Sequence:CCGGCCAAGAGAAACGCCGATTAAACTCGAGTTTAATCGGCGTTTCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_024617.2-5467s21c1
Sequence:CCGGGCTGAAGATCAAAGAGGTTATCTCGAGATAACCTCTTTGATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_024617.2-3734s21c1
Sequence:CCGGTACTCTTATGGTGCTATATTTCTCGAGAAATATAGCACCATAAGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_024617.2-1794s21c1
Sequence:CCGGCCAAGAGAAACGCCGATTAAACTCGAGTTTAATCGGCGTTTCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_024617.2-2790s21c1
Sequence:CCGGGAACCTAGGCTCACCATTAACCTCGAGGTTAATGGTGAGCCTAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_024617.2-3119s21c1
Sequence:CCGGCAAACGAGAGGGTCATCTAAACTCGAGTTTAGATGACCCTCTCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024617
VALIDATED
ZCCHC6 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024617.2-5467s1c1
Sequence:CCGGGCTGAAGATCAAAGAGGTTATCTCGAGATAACCTCTTTGATCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024617.2-3712s1c1
Sequence:CCGGGCAGCTTATCATCGTATGCATCTCGAGATGCATACGATGATAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024617.2-4979s1c1
Sequence:CCGGCGGTATTCAGTGAATACAGTTCTCGAGAACTGTATTCACTGAATACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_024617.2-1794s1c1
Sequence:CCGGCCAAGAGAAACGCCGATTAAACTCGAGTTTAATCGGCGTTTCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_024617.2-5467s21c1
Sequence:CCGGGCTGAAGATCAAAGAGGTTATCTCGAGATAACCTCTTTGATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_024617.2-3734s21c1
Sequence:CCGGTACTCTTATGGTGCTATATTTCTCGAGAAATATAGCACCATAAGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_024617.2-1794s21c1
Sequence:CCGGCCAAGAGAAACGCCGATTAAACTCGAGTTTAATCGGCGTTTCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_024617.2-2790s21c1
Sequence:CCGGGAACCTAGGCTCACCATTAACCTCGAGGTTAATGGTGAGCCTAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_024617.2-3119s21c1
Sequence:CCGGCAAACGAGAGGGTCATCTAAACTCGAGTTTAGATGACCCTCTCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks