EMAIL THIS PAGE TO A FRIEND

ZCCHC7

zinc finger, CCHC domain containing 7

Synonyms: AIR1 RP11-397D12.1
Gene ID:
Mouse(319885) zinc finger, CCHC domain containing 7
Rat(298086) zinc finger, CCHC domain containing 7
naked mole-rat(101700447) zinc finger, CCHC domain containing 7
domestic guinea pig(100732205) zinc finger, CCHC domain containing 7
cow(511821) zinc finger, CCHC domain containing 7
sheep(101108453) zinc finger, CCHC domain containing 7
Zebrafish(317641) zinc finger, CCHC domain containing 7
domestic cat(101089808) zinc finger, CCHC domain containing 7
dog(481611) zinc finger, CCHC domain containing 7
chicken(426807) zinc finger, CCHC domain containing 7
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032226 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032226 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032226 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138590 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138590 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138590 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_177027 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177027 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177027 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU089821 MISSION® esiRNA esiRNA human ZCCHC7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032226 Rosetta Predictions human pricing
NM_001106658 Rosetta Predictions rat pricing
NM_138590 Rosetta Predictions mouse pricing
NM_177027 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181612 predicted 863
2 SASI_Hs01_00181613 predicted 583
3 SASI_Hs02_00359531 predicted 663
4 SASI_Hs02_00359532 predicted 531
5 SASI_Hs01_00181619 predicted 909
6 SASI_Hs02_00359533 predicted 902
7 SASI_Hs02_00359534 predicted 710
8 SASI_Hs01_00181614 predicted 349
9 SASI_Hs01_00181615 predicted 228
10 SASI_Hs01_00181616 predicted 452
11 SASI_Hs01_00181617 predicted 1196
12 SASI_Hs01_00181618 predicted 971
13 SASI_Hs01_00181620 predicted 1222
14 SASI_Hs01_00181621 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106658 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221118 predicted 322
2 SASI_Rn02_00221119 predicted 650
3 SASI_Rn02_00221120 predicted 728
4 SASI_Rn02_00221121 predicted 1103
5 SASI_Rn02_00221122 predicted 311
6 SASI_Rn02_00221123 predicted 398
7 SASI_Rn02_00221124 predicted 1059
8 SASI_Rn02_00221125 predicted 1020
9 SASI_Rn02_00221126 predicted 969
10 SASI_Rn02_00221127 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138590 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339646 predicted 339
2 SASI_Mm02_00339647 predicted 513
3 SASI_Mm02_00339648 predicted 822
4 SASI_Mm02_00339649 predicted 252
5 SASI_Mm02_00339650 predicted 239
6 SASI_Mm02_00339651 predicted 749
7 SASI_Mm02_00339652 predicted 422
8 SASI_Mm02_00339653 predicted 318
9 SASI_Mm02_00339654 predicted 354
10 SASI_Mm02_00339655 predicted 203
11 SASI_Mm01_00045421 predicted 2007
12 SASI_Mm01_00045422 predicted 2053
13 SASI_Mm01_00045423 predicted 1952
14 SASI_Mm01_00045424 predicted 2410
15 SASI_Mm01_00045425 predicted 1961
16 SASI_Mm01_00045426 predicted 2502
17 SASI_Mm01_00045427 predicted 2049
18 SASI_Mm01_00045428 predicted 1998
19 SASI_Mm01_00045429 predicted 1940
20 SASI_Mm01_00045430 predicted 1910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177027 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060797 predicted 334
2 SASI_Mm02_00346981 predicted 511
3 SASI_Mm01_00060798 predicted 822
4 SASI_Mm02_00346982 predicted 260
5 SASI_Mm01_00060799 predicted 240
6 SASI_Mm01_00060800 predicted 743
7 SASI_Mm01_00060804 predicted 424
8 SASI_Mm01_00060805 predicted 322
9 SASI_Mm01_00060806 predicted 354
10 SASI_Mm02_00346983 predicted 207
11 SASI_Mm01_00060801 predicted 508
12 SASI_Mm01_00060802 predicted 1163
13 SASI_Mm01_00060803 predicted 269
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032226
VALIDATED
ZCCHC7 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 7
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032226.2-1639s21c1
Sequence:CCGGAGAAGCCTTCTAAGCCCTTTCCTCGAGGAAAGGGCTTAGAAGGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032226.2-441s21c1
Sequence:CCGGGAGGTCATCACTTTGTCTGATCTCGAGATCAGACAAAGTGATGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032226.2-619s21c1
Sequence:CCGGTCCGAGAGGTCATGATTATAGCTCGAGCTATAATCATGACCTCTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032226.2-355s21c1
Sequence:CCGGATTCGGAATCTTCGAGTAGTACTCGAGTACTACTCGAAGATTCCGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032226.2-580s21c1
Sequence:CCGGATATTGAGAAGCCTAAATCTGCTCGAGCAGATTTAGGCTTCTCAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032226.2-832s21c1
Sequence:CCGGAGATAGCTAATAACCGAACACCTCGAGGTGTTCGGTTATTAGCTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032226.2-1242s21c1
Sequence:CCGGGGCCATTATGGACACGAATGTCTCGAGACATTCGTGTCCATAATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032226.2-1953s21c1
Sequence:CCGGATATCCATGGAGATCTCAATTCTCGAGAATTGAGATCTCCATGGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032226.2-2228s21c1
Sequence:CCGGTACTTTGGAAAGGACAATAACCTCGAGGTTATTGTCCTTTCCAAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032226.1-987s1c1
Sequence:CCGGGCGGTACTATTCAGCCAACAACTCGAGTTGTTGGCTGAATAGTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032226.1-1404s1c1
Sequence:CCGGGTCTCCAGTATCTCCATTCATCTCGAGATGAATGGAGATACTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032226.1-661s1c1
Sequence:CCGGCAATCTAATGAGCTGGTTGATCTCGAGATCAACCAGCTCATTAGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032226.1-343s1c1
Sequence:CCGGCGAGATGAGTCATCTAGTGAACTCGAGTTCACTAGATGACTCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032226.1-1794s1c1
Sequence:CCGGCCACACGTCAAGAGAAGACAACTCGAGTTGTCTTCTCTTGACGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032226
VALIDATED
ZCCHC7 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 7
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032226.2-1639s21c1
Sequence:CCGGAGAAGCCTTCTAAGCCCTTTCCTCGAGGAAAGGGCTTAGAAGGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032226.2-441s21c1
Sequence:CCGGGAGGTCATCACTTTGTCTGATCTCGAGATCAGACAAAGTGATGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032226.2-619s21c1
Sequence:CCGGTCCGAGAGGTCATGATTATAGCTCGAGCTATAATCATGACCTCTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032226.2-355s21c1
Sequence:CCGGATTCGGAATCTTCGAGTAGTACTCGAGTACTACTCGAAGATTCCGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032226.2-580s21c1
Sequence:CCGGATATTGAGAAGCCTAAATCTGCTCGAGCAGATTTAGGCTTCTCAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032226.2-832s21c1
Sequence:CCGGAGATAGCTAATAACCGAACACCTCGAGGTGTTCGGTTATTAGCTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032226.2-1242s21c1
Sequence:CCGGGGCCATTATGGACACGAATGTCTCGAGACATTCGTGTCCATAATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032226.2-1953s21c1
Sequence:CCGGATATCCATGGAGATCTCAATTCTCGAGAATTGAGATCTCCATGGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032226.2-2228s21c1
Sequence:CCGGTACTTTGGAAAGGACAATAACCTCGAGGTTATTGTCCTTTCCAAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032226.1-987s1c1
Sequence:CCGGGCGGTACTATTCAGCCAACAACTCGAGTTGTTGGCTGAATAGTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032226.1-1404s1c1
Sequence:CCGGGTCTCCAGTATCTCCATTCATCTCGAGATGAATGGAGATACTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032226.1-661s1c1
Sequence:CCGGCAATCTAATGAGCTGGTTGATCTCGAGATCAACCAGCTCATTAGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032226.1-343s1c1
Sequence:CCGGCGAGATGAGTCATCTAGTGAACTCGAGTTCACTAGATGACTCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032226.1-1794s1c1
Sequence:CCGGCCACACGTCAAGAGAAGACAACTCGAGTTGTCTTCTCTTGACGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032226
VALIDATED
ZCCHC7 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 7
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032226.2-1639s21c1
Sequence:CCGGAGAAGCCTTCTAAGCCCTTTCCTCGAGGAAAGGGCTTAGAAGGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032226.2-441s21c1
Sequence:CCGGGAGGTCATCACTTTGTCTGATCTCGAGATCAGACAAAGTGATGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032226.2-619s21c1
Sequence:CCGGTCCGAGAGGTCATGATTATAGCTCGAGCTATAATCATGACCTCTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032226.2-355s21c1
Sequence:CCGGATTCGGAATCTTCGAGTAGTACTCGAGTACTACTCGAAGATTCCGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032226.2-580s21c1
Sequence:CCGGATATTGAGAAGCCTAAATCTGCTCGAGCAGATTTAGGCTTCTCAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032226.2-832s21c1
Sequence:CCGGAGATAGCTAATAACCGAACACCTCGAGGTGTTCGGTTATTAGCTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032226.2-1242s21c1
Sequence:CCGGGGCCATTATGGACACGAATGTCTCGAGACATTCGTGTCCATAATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032226.2-1953s21c1
Sequence:CCGGATATCCATGGAGATCTCAATTCTCGAGAATTGAGATCTCCATGGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032226.2-2228s21c1
Sequence:CCGGTACTTTGGAAAGGACAATAACCTCGAGGTTATTGTCCTTTCCAAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032226.1-987s1c1
Sequence:CCGGGCGGTACTATTCAGCCAACAACTCGAGTTGTTGGCTGAATAGTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032226.1-1404s1c1
Sequence:CCGGGTCTCCAGTATCTCCATTCATCTCGAGATGAATGGAGATACTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032226.1-661s1c1
Sequence:CCGGCAATCTAATGAGCTGGTTGATCTCGAGATCAACCAGCTCATTAGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032226.1-343s1c1
Sequence:CCGGCGAGATGAGTCATCTAGTGAACTCGAGTTCACTAGATGACTCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032226.1-1794s1c1
Sequence:CCGGCCACACGTCAAGAGAAGACAACTCGAGTTGTCTTCTCTTGACGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138590
VALIDATED
ZCCHC7 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 7
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215367    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138590.3-2165s1c1
Sequence:CCGGCTGTACAGAACAGCATGTAAACTCGAGTTTACATGCTGTTCTGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215929    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138590.3-2013s1c1
Sequence:CCGGCTCCAATGTTTGAGGACTTAACTCGAGTTAAGTCCTCAAACATTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215988    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138590.3-2037s1c1
Sequence:CCGGCTCATTGGAAGAAAGTTTATTCTCGAGAATAAACTTTCTTCCAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138590.3-1051s21c1
Sequence:CCGGGTGACCGATGTGATATGATAGCTCGAGCTATCATATCACATCGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138590.3-1989s21c1
Sequence:CCGGTACAAGCTCATCAGATGATTTCTCGAGAAATCATCTGATGAGCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138590.3-830s21c1
Sequence:CCGGCCGATACTATTCAGTCAACAACTCGAGTTGTTGACTGAATAGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138590.3-249s21c1
Sequence:CCGGCTCTACAGCCAAGTCCATTATCTCGAGATAATGGACTTGGCTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138590.3-1192s21c1
Sequence:CCGGGTGCACAGAAAGGCCATTATGCTCGAGCATAATGGCCTTTCTGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138590.2-2415s1c1
Sequence:CCGGGCCATGATGATTTGTTTCTTACTCGAGTAAGAAACAAATCATCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138590.2-1969s1c1
Sequence:CCGGCATATATTGCTATGATGGCAACTCGAGTTGCCATCATAGCAATATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_138590.2-1934s1c1
Sequence:CCGGCGAATGTTTAACCAGACGTTTCTCGAGAAACGTCTGGTTAAACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138590.2-1905s1c1
Sequence:CCGGGCCATTATGGACATGAATGTACTCGAGTACATTCATGTCCATAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138590.2-2002s1c1
Sequence:CCGGGCAAAGGGATCGGAGAATAAACTCGAGTTTATTCTCCGATCCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138590
VALIDATED
ZCCHC7 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 7
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215367    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138590.3-2165s1c1
Sequence:CCGGCTGTACAGAACAGCATGTAAACTCGAGTTTACATGCTGTTCTGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215929    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138590.3-2013s1c1
Sequence:CCGGCTCCAATGTTTGAGGACTTAACTCGAGTTAAGTCCTCAAACATTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215988    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138590.3-2037s1c1
Sequence:CCGGCTCATTGGAAGAAAGTTTATTCTCGAGAATAAACTTTCTTCCAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138590.3-1051s21c1
Sequence:CCGGGTGACCGATGTGATATGATAGCTCGAGCTATCATATCACATCGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138590.3-1989s21c1
Sequence:CCGGTACAAGCTCATCAGATGATTTCTCGAGAAATCATCTGATGAGCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138590.3-830s21c1
Sequence:CCGGCCGATACTATTCAGTCAACAACTCGAGTTGTTGACTGAATAGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138590.3-249s21c1
Sequence:CCGGCTCTACAGCCAAGTCCATTATCTCGAGATAATGGACTTGGCTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138590.3-1192s21c1
Sequence:CCGGGTGCACAGAAAGGCCATTATGCTCGAGCATAATGGCCTTTCTGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138590.2-2415s1c1
Sequence:CCGGGCCATGATGATTTGTTTCTTACTCGAGTAAGAAACAAATCATCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138590.2-1969s1c1
Sequence:CCGGCATATATTGCTATGATGGCAACTCGAGTTGCCATCATAGCAATATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_138590.2-1934s1c1
Sequence:CCGGCGAATGTTTAACCAGACGTTTCTCGAGAAACGTCTGGTTAAACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138590.2-1905s1c1
Sequence:CCGGGCCATTATGGACATGAATGTACTCGAGTACATTCATGTCCATAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138590.2-2002s1c1
Sequence:CCGGGCAAAGGGATCGGAGAATAAACTCGAGTTTATTCTCCGATCCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138590
VALIDATED
ZCCHC7 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 7
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215367    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138590.3-2165s1c1
Sequence:CCGGCTGTACAGAACAGCATGTAAACTCGAGTTTACATGCTGTTCTGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215929    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138590.3-2013s1c1
Sequence:CCGGCTCCAATGTTTGAGGACTTAACTCGAGTTAAGTCCTCAAACATTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215988    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138590.3-2037s1c1
Sequence:CCGGCTCATTGGAAGAAAGTTTATTCTCGAGAATAAACTTTCTTCCAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138590.3-1051s21c1
Sequence:CCGGGTGACCGATGTGATATGATAGCTCGAGCTATCATATCACATCGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138590.3-1989s21c1
Sequence:CCGGTACAAGCTCATCAGATGATTTCTCGAGAAATCATCTGATGAGCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138590.3-830s21c1
Sequence:CCGGCCGATACTATTCAGTCAACAACTCGAGTTGTTGACTGAATAGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138590.3-249s21c1
Sequence:CCGGCTCTACAGCCAAGTCCATTATCTCGAGATAATGGACTTGGCTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138590.3-1192s21c1
Sequence:CCGGGTGCACAGAAAGGCCATTATGCTCGAGCATAATGGCCTTTCTGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138590.2-2415s1c1
Sequence:CCGGGCCATGATGATTTGTTTCTTACTCGAGTAAGAAACAAATCATCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138590.2-1969s1c1
Sequence:CCGGCATATATTGCTATGATGGCAACTCGAGTTGCCATCATAGCAATATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_138590.2-1934s1c1
Sequence:CCGGCGAATGTTTAACCAGACGTTTCTCGAGAAACGTCTGGTTAAACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138590.2-1905s1c1
Sequence:CCGGGCCATTATGGACATGAATGTACTCGAGTACATTCATGTCCATAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138590.2-2002s1c1
Sequence:CCGGGCAAAGGGATCGGAGAATAAACTCGAGTTTATTCTCCGATCCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177027
VALIDATED
ZCCHC7 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201386    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177027.2-1353s1c1
Sequence:CCGGGCGTCTTTAGAACACTGTGTTCTCGAGAACACAGTGTTCTAAAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_177027.2-752s1c1
Sequence:CCGGCCGATACTATTCAGTCAACAACTCGAGTTGTTGACTGAATAGTATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177027.2-1031s1c1
Sequence:CCGGGTATCACCTAACGGTGAGTAACTCGAGTTACTCACCGTTAGGTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177027.2-120s1c1
Sequence:CCGGCGTGATGATTCATCTAGTGAACTCGAGTTCACTAGATGAATCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191497    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177027.2-1395s1c1
Sequence:CCGGGCCCACAATATCATCCATTATCTCGAGATAATGGATGATATTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177027
VALIDATED
ZCCHC7 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201386    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177027.2-1353s1c1
Sequence:CCGGGCGTCTTTAGAACACTGTGTTCTCGAGAACACAGTGTTCTAAAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_177027.2-752s1c1
Sequence:CCGGCCGATACTATTCAGTCAACAACTCGAGTTGTTGACTGAATAGTATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177027.2-1031s1c1
Sequence:CCGGGTATCACCTAACGGTGAGTAACTCGAGTTACTCACCGTTAGGTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177027.2-120s1c1
Sequence:CCGGCGTGATGATTCATCTAGTGAACTCGAGTTCACTAGATGAATCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191497    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177027.2-1395s1c1
Sequence:CCGGGCCCACAATATCATCCATTATCTCGAGATAATGGATGATATTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177027
VALIDATED
ZCCHC7 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201386    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177027.2-1353s1c1
Sequence:CCGGGCGTCTTTAGAACACTGTGTTCTCGAGAACACAGTGTTCTAAAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_177027.2-752s1c1
Sequence:CCGGCCGATACTATTCAGTCAACAACTCGAGTTGTTGACTGAATAGTATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177027.2-1031s1c1
Sequence:CCGGGTATCACCTAACGGTGAGTAACTCGAGTTACTCACCGTTAGGTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177027.2-120s1c1
Sequence:CCGGCGTGATGATTCATCTAGTGAACTCGAGTTCACTAGATGAATCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191497    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177027.2-1395s1c1
Sequence:CCGGGCCCACAATATCATCCATTATCTCGAGATAATGGATGATATTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks