EMAIL THIS PAGE TO A FRIEND

ZCCHC8

zinc finger, CCHC domain containing 8

UniProtKB ID: Q6NZY4, Q7L2P6, Q8N2K5, Q96SK7, Q9NSS2, Q9NSS3
Gene ID:
Mouse(70650) zinc finger, CCHC domain containing 8
Rat(288661) zinc finger, CCHC domain containing 8
Zebrafish(553372) zinc finger, CCHC domain containing 8
Horse(100058826) zinc finger, CCHC domain containing 8
domestic cat(101089217) zinc finger, CCHC domain containing 8
dog(477460) zinc finger, CCHC domain containing 8
chicken(416862) zinc finger, CCHC domain containing 8
cow(539598) zinc finger, CCHC domain containing 8
sheep(101120863) zinc finger, CCHC domain containing 8
domestic guinea pig(100713526) zinc finger, CCHC domain containing 8
naked mole-rat(101712230) zinc finger, CCHC domain containing 8
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017612 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017612 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017612 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027494 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027494 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027494 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017612 Rosetta Predictions human pricing
NM_001105929 Rosetta Predictions rat pricing
NM_027494 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017612 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130491 predicted 388
2 SASI_Hs01_00130492 predicted 1000
3 SASI_Hs01_00130493 predicted 2112
4 SASI_Hs01_00130494 predicted 590
5 SASI_Hs01_00130496 predicted 861
6 SASI_Hs01_00130497 predicted 1668
7 SASI_Hs01_00130498 predicted 729
8 SASI_Hs02_00350283 predicted 347
9 SASI_Hs01_00130499 predicted 1426
10 SASI_Hs01_00130500 predicted 2239
11 SASI_Hs01_00130495 predicted 1330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105929 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213932 predicted 2226
2 SASI_Rn02_00213933 predicted 1577
3 SASI_Rn02_00213934 predicted 2164
4 SASI_Rn02_00213935 predicted 1026
5 SASI_Rn02_00213936 predicted 2161
6 SASI_Rn02_00213937 predicted 1346
7 SASI_Rn02_00213938 predicted 1044
8 SASI_Rn02_00213939 predicted 1889
9 SASI_Rn02_00213940 predicted 2152
10 SASI_Rn02_00213941 predicted 1572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027494 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129756 predicted 2158
2 SASI_Mm01_00129757 predicted 577
3 SASI_Mm01_00129759 predicted 2001
4 SASI_Mm01_00129760 predicted 798
5 SASI_Mm01_00129761 predicted 718
6 SASI_Mm01_00129762 predicted 1257
7 SASI_Mm01_00129763 predicted 957
8 SASI_Mm01_00129764 predicted 2110
9 SASI_Mm02_00332321 predicted 2178
10 SASI_Mm01_00129765 predicted 578
11 SASI_Mm01_00129758 predicted 1391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017612
VALIDATED
ZCCHC8 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_017612.2-2416s1c1
Sequence:CCGGGCTCACTAGTTCAGTATATTTCTCGAGAAATATACTGAACTAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_017612.2-993s1c1
Sequence:CCGGCCAGGAGTTATTAGTGAGGAACTCGAGTTCCTCACTAATAACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017612.2-322s1c1
Sequence:CCGGGCGCCGAGAATCAAGAACTTACTCGAGTAAGTTCTTGATTCTCGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_017612.2-323s1c1
Sequence:CCGGCGCCGAGAATCAAGAACTTAACTCGAGTTAAGTTCTTGATTCTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017612.2-2143s1c1
Sequence:CCGGCGCCATTTGAATTTGAGAATACTCGAGTATTCTCAAATTCAAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017612.2-395s21c1
Sequence:CCGGTAAGTTAGATGGACCTATATTCTCGAGAATATAGGTCCATCTAACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_017612.2-865s21c1
Sequence:CCGGCTCGGAATGCTGCTCGAATAACTCGAGTTATTCGAGCAGCATTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_017612.2-2265s21c1
Sequence:GTACCGGTTAGCACTGAGAGCTATTTAACTCGAGTTAAATAGCTCTCAGTGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_017612.2-985s21c1
Sequence:CCGGGATTCAAGCCAGGAGTTATTACTCGAGTAATAACTCCTGGCTTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_017612.2-773s21c1
Sequence:CCGGAGGGCAAGAAATACAAGTAAACTCGAGTTTACTTGTATTTCTTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017612
VALIDATED
ZCCHC8 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_017612.2-2416s1c1
Sequence:CCGGGCTCACTAGTTCAGTATATTTCTCGAGAAATATACTGAACTAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_017612.2-993s1c1
Sequence:CCGGCCAGGAGTTATTAGTGAGGAACTCGAGTTCCTCACTAATAACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017612.2-322s1c1
Sequence:CCGGGCGCCGAGAATCAAGAACTTACTCGAGTAAGTTCTTGATTCTCGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_017612.2-323s1c1
Sequence:CCGGCGCCGAGAATCAAGAACTTAACTCGAGTTAAGTTCTTGATTCTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017612.2-2143s1c1
Sequence:CCGGCGCCATTTGAATTTGAGAATACTCGAGTATTCTCAAATTCAAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017612.2-395s21c1
Sequence:CCGGTAAGTTAGATGGACCTATATTCTCGAGAATATAGGTCCATCTAACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_017612.2-865s21c1
Sequence:CCGGCTCGGAATGCTGCTCGAATAACTCGAGTTATTCGAGCAGCATTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_017612.2-2265s21c1
Sequence:GTACCGGTTAGCACTGAGAGCTATTTAACTCGAGTTAAATAGCTCTCAGTGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_017612.2-985s21c1
Sequence:CCGGGATTCAAGCCAGGAGTTATTACTCGAGTAATAACTCCTGGCTTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_017612.2-773s21c1
Sequence:CCGGAGGGCAAGAAATACAAGTAAACTCGAGTTTACTTGTATTTCTTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017612
VALIDATED
ZCCHC8 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_017612.2-2416s1c1
Sequence:CCGGGCTCACTAGTTCAGTATATTTCTCGAGAAATATACTGAACTAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_017612.2-993s1c1
Sequence:CCGGCCAGGAGTTATTAGTGAGGAACTCGAGTTCCTCACTAATAACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017612.2-322s1c1
Sequence:CCGGGCGCCGAGAATCAAGAACTTACTCGAGTAAGTTCTTGATTCTCGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_017612.2-323s1c1
Sequence:CCGGCGCCGAGAATCAAGAACTTAACTCGAGTTAAGTTCTTGATTCTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017612.2-2143s1c1
Sequence:CCGGCGCCATTTGAATTTGAGAATACTCGAGTATTCTCAAATTCAAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017612.2-395s21c1
Sequence:CCGGTAAGTTAGATGGACCTATATTCTCGAGAATATAGGTCCATCTAACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_017612.2-865s21c1
Sequence:CCGGCTCGGAATGCTGCTCGAATAACTCGAGTTATTCGAGCAGCATTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_017612.2-2265s21c1
Sequence:GTACCGGTTAGCACTGAGAGCTATTTAACTCGAGTTAAATAGCTCTCAGTGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_017612.2-985s21c1
Sequence:CCGGGATTCAAGCCAGGAGTTATTACTCGAGTAATAACTCCTGGCTTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_017612.2-773s21c1
Sequence:CCGGAGGGCAAGAAATACAAGTAAACTCGAGTTTACTTGTATTTCTTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027494
ZCCHC8 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123779    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027494.1-2216s1c1
Sequence:CCGGCCTTTCAGAATCTGGTGTAATCTCGAGATTACACCAGATTCTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027494.1-1193s1c1
Sequence:CCGGTGTCAACAGAAGGATGTGTTTCTCGAGAAACACATCCTTCTGTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027494.1-443s1c1
Sequence:CCGGCCGTCCAGTGTTATGTTGGAACTCGAGTTCCAACATAACACTGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027494.1-212s1c1
Sequence:CCGGGCCGAGAATCAAGAACTTAAACTCGAGTTTAAGTTCTTGATTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027494.1-1900s1c1
Sequence:CCGGCGGTGTGTTGAACATGAACATCTCGAGATGTTCATGTTCAACACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027494.3-316s21c1
Sequence:CCGGGCCGAGAATCAAGAACTTAAACTCGAGTTTAAGTTCTTGATTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027494.3-2320s21c1
Sequence:CCGGCCTTTCAGAATCTGGTGTAATCTCGAGATTACACCAGATTCTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027494.3-547s21c1
Sequence:CCGGCCGTCCAGTGTTATGTTGGAACTCGAGTTCCAACATAACACTGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027494.3-2004s21c1
Sequence:CCGGCGGTGTGTTGAACATGAACATCTCGAGATGTTCATGTTCAACACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027494.3-1297s21c1
Sequence:CCGGTGTCAACAGAAGGATGTGTTTCTCGAGAAACACATCCTTCTGTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027494
ZCCHC8 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123779    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027494.1-2216s1c1
Sequence:CCGGCCTTTCAGAATCTGGTGTAATCTCGAGATTACACCAGATTCTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027494.1-1193s1c1
Sequence:CCGGTGTCAACAGAAGGATGTGTTTCTCGAGAAACACATCCTTCTGTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027494.1-443s1c1
Sequence:CCGGCCGTCCAGTGTTATGTTGGAACTCGAGTTCCAACATAACACTGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027494.1-212s1c1
Sequence:CCGGGCCGAGAATCAAGAACTTAAACTCGAGTTTAAGTTCTTGATTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027494.1-1900s1c1
Sequence:CCGGCGGTGTGTTGAACATGAACATCTCGAGATGTTCATGTTCAACACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027494.3-316s21c1
Sequence:CCGGGCCGAGAATCAAGAACTTAAACTCGAGTTTAAGTTCTTGATTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027494.3-2320s21c1
Sequence:CCGGCCTTTCAGAATCTGGTGTAATCTCGAGATTACACCAGATTCTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027494.3-547s21c1
Sequence:CCGGCCGTCCAGTGTTATGTTGGAACTCGAGTTCCAACATAACACTGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027494.3-2004s21c1
Sequence:CCGGCGGTGTGTTGAACATGAACATCTCGAGATGTTCATGTTCAACACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027494.3-1297s21c1
Sequence:CCGGTGTCAACAGAAGGATGTGTTTCTCGAGAAACACATCCTTCTGTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027494
ZCCHC8 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123779    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027494.1-2216s1c1
Sequence:CCGGCCTTTCAGAATCTGGTGTAATCTCGAGATTACACCAGATTCTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027494.1-1193s1c1
Sequence:CCGGTGTCAACAGAAGGATGTGTTTCTCGAGAAACACATCCTTCTGTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027494.1-443s1c1
Sequence:CCGGCCGTCCAGTGTTATGTTGGAACTCGAGTTCCAACATAACACTGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027494.1-212s1c1
Sequence:CCGGGCCGAGAATCAAGAACTTAAACTCGAGTTTAAGTTCTTGATTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027494.1-1900s1c1
Sequence:CCGGCGGTGTGTTGAACATGAACATCTCGAGATGTTCATGTTCAACACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027494.3-316s21c1
Sequence:CCGGGCCGAGAATCAAGAACTTAAACTCGAGTTTAAGTTCTTGATTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027494.3-2320s21c1
Sequence:CCGGCCTTTCAGAATCTGGTGTAATCTCGAGATTACACCAGATTCTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027494.3-547s21c1
Sequence:CCGGCCGTCCAGTGTTATGTTGGAACTCGAGTTCCAACATAACACTGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027494.3-2004s21c1
Sequence:CCGGCGGTGTGTTGAACATGAACATCTCGAGATGTTCATGTTCAACACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027494.3-1297s21c1
Sequence:CCGGTGTCAACAGAAGGATGTGTTTCTCGAGAAACACATCCTTCTGTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks