EMAIL THIS PAGE TO A FRIEND

ZCCHC9

zinc finger, CCHC domain containing 9

Synonyms: PPP1R41
UniProtKB ID: Q8N567, B2RAE7, Q9H027
Gene ID:
Mouse(69085) zinc finger, CCHC domain containing 9
Rat(309986) zinc finger, CCHC domain containing 9
naked mole-rat(101704288) zinc finger, CCHC domain containing 9
domestic guinea pig(100721576) zinc finger, CCHC domain containing 9
cow(506049) zinc finger, CCHC domain containing 9
sheep(101122436) zinc finger, CCHC domain containing 9
Zebrafish(386639) zinc finger, CCHC domain containing 9
domestic cat(101088460) zinc finger, CCHC domain containing 9
dog(479161) zinc finger, CCHC domain containing 9
chicken(427320) zinc finger, CCHC domain containing 9
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032280 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032280 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032280 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145453 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145453 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145453 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU060531 MISSION® esiRNA esiRNA targeting mouse Zcchc9 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032280 Rosetta Predictions human pricing
NM_001013156 Rosetta Predictions rat pricing
NM_145453 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214760 predicted 3984
2 SASI_Hs02_00359600 predicted 3636
3 SASI_Hs01_00214761 predicted 3650
4 SASI_Hs01_00214762 predicted 3602
5 SASI_Hs01_00214763 predicted 4066
6 SASI_Hs01_00214764 predicted 3904
7 SASI_Hs01_00214765 predicted 3858
8 SASI_Hs01_00214766 predicted 3831
9 SASI_Hs01_00214767 predicted 4050
10 SASI_Hs01_00214769 predicted 3654
11 SASI_Hs01_00214768 predicted 3882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013156 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119332 predicted 534
2 SASI_Rn01_00119333 predicted 244
3 SASI_Rn01_00119334 predicted 480
4 SASI_Rn01_00119335 predicted 521
5 SASI_Rn01_00119337 predicted 274
6 SASI_Rn01_00119338 predicted 236
7 SASI_Rn01_00119339 predicted 270
8 SASI_Rn01_00119340 predicted 414
9 SASI_Rn01_00119341 predicted 790
10 SASI_Rn02_00200885 predicted 479
11 SASI_Rn01_00119336 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145453 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021379 predicted 519
2 SASI_Mm01_00021380 predicted 695
3 SASI_Mm01_00021381 predicted 841
4 SASI_Mm01_00021382 predicted 557
5 SASI_Mm01_00021383 predicted 598
6 SASI_Mm01_00021384 predicted 856
7 SASI_Mm01_00021387 predicted 552
8 SASI_Mm01_00021388 predicted 814
9 SASI_Mm02_00340841 predicted 569
10 SASI_Mm02_00340842 predicted 875
11 SASI_Mm01_00021385 predicted 794
12 SASI_Mm01_00021386 predicted 627
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032280
VALIDATED
ZCCHC9 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 9
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032280.2-1682s21c1
Sequence:CCGGTCTTGGCTCAAAGTATCAATTCTCGAGAATTGATACTTTGAGCCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032280.2-1402s21c1
Sequence:CCGGTATGCTGTAGATATCAGTATGCTCGAGCATACTGATATCTACAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032280.2-1218s21c1
Sequence:CCGGAGGGAATGAGTGCAGACTATGCTCGAGCATAGTCTGCACTCATTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032280.1-3646s1c1
Sequence:CCGGGCACGAAATAACCAAGTGTAACTCGAGTTACACTTGGTTATTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032280.1-3912s1c1
Sequence:CCGGTGGATGTACCTAAACCGCAAACTCGAGTTTGCGGTTTAGGTACATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032280.1-3263s1c1
Sequence:CCGGCCAAAGCGTAAACAACTTGAACTCGAGTTCAAGTTGTTTACGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032280.1-3408s1c1
Sequence:CCGGTGGTTCACAATGGGCAAATTACTCGAGTAATTTGCCCATTGTGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032280
VALIDATED
ZCCHC9 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 9
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032280.2-1682s21c1
Sequence:CCGGTCTTGGCTCAAAGTATCAATTCTCGAGAATTGATACTTTGAGCCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032280.2-1402s21c1
Sequence:CCGGTATGCTGTAGATATCAGTATGCTCGAGCATACTGATATCTACAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032280.2-1218s21c1
Sequence:CCGGAGGGAATGAGTGCAGACTATGCTCGAGCATAGTCTGCACTCATTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032280.1-3646s1c1
Sequence:CCGGGCACGAAATAACCAAGTGTAACTCGAGTTACACTTGGTTATTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032280.1-3912s1c1
Sequence:CCGGTGGATGTACCTAAACCGCAAACTCGAGTTTGCGGTTTAGGTACATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032280.1-3263s1c1
Sequence:CCGGCCAAAGCGTAAACAACTTGAACTCGAGTTCAAGTTGTTTACGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032280.1-3408s1c1
Sequence:CCGGTGGTTCACAATGGGCAAATTACTCGAGTAATTTGCCCATTGTGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032280
VALIDATED
ZCCHC9 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 9
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032280.2-1682s21c1
Sequence:CCGGTCTTGGCTCAAAGTATCAATTCTCGAGAATTGATACTTTGAGCCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032280.2-1402s21c1
Sequence:CCGGTATGCTGTAGATATCAGTATGCTCGAGCATACTGATATCTACAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032280.2-1218s21c1
Sequence:CCGGAGGGAATGAGTGCAGACTATGCTCGAGCATAGTCTGCACTCATTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032280.1-3646s1c1
Sequence:CCGGGCACGAAATAACCAAGTGTAACTCGAGTTACACTTGGTTATTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032280.1-3912s1c1
Sequence:CCGGTGGATGTACCTAAACCGCAAACTCGAGTTTGCGGTTTAGGTACATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032280.1-3263s1c1
Sequence:CCGGCCAAAGCGTAAACAACTTGAACTCGAGTTCAAGTTGTTTACGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032280.1-3408s1c1
Sequence:CCGGTGGTTCACAATGGGCAAATTACTCGAGTAATTTGCCCATTGTGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145453
VALIDATED
ZCCHC9 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 9
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145453.2-928s1c1
Sequence:CCGGGATACTAATTGGTACAATTGTCTCGAGACAATTGTACCAATTAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145453.2-879s1c1
Sequence:CCGGCCCAAACTGCAGAAACCTAAACTCGAGTTTAGGTTTCTGCAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145453.2-927s21c1
Sequence:CCGGTGATACTAATTGGTACAATTGCTCGAGCAATTGTACCAATTAGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145453.2-905s21c1
Sequence:CCGGAGTACCCAAAGTTGTTAATTTCTCGAGAAATTAACAACTTTGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340505    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145453.2-1395s21c1
Sequence:CCGGGCCTTTCAGCTTGTGAATCAACTCGAGTTGATTCACAAGCTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145453.2-1044s21c1
Sequence:CCGGCCTTGGTAGCTTGCCTACAATCTCGAGATTGTAGGCAAGCTACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201138    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145453.1-1306s1c1
Sequence:CCGGCCTTTCAGCTTGTGAATCAAACTCGAGTTTGATTCACAAGCTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145453.1-960s1c1
Sequence:CCGGCCTTGGTAGCTTGCCTACAATCTCGAGATTGTAGGCAAGCTACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190681    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145453.1-1305s1c1
Sequence:CCGGGCCTTTCAGCTTGTGAATCAACTCGAGTTGATTCACAAGCTGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145453.1-138s1c1
Sequence:CCGGCAAATCGTAAGCAGTGTCAAACTCGAGTTTGACACTGCTTACGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145453.1-127s1c1
Sequence:CCGGCCAAAGCCTTCCAAATCGTAACTCGAGTTACGATTTGGAAGGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145453.1-400s1c1
Sequence:CCGGGAAGAATGCAATGGTGTGTTTCTCGAGAAACACACCATTGCATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145453
VALIDATED
ZCCHC9 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 9
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145453.2-928s1c1
Sequence:CCGGGATACTAATTGGTACAATTGTCTCGAGACAATTGTACCAATTAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145453.2-879s1c1
Sequence:CCGGCCCAAACTGCAGAAACCTAAACTCGAGTTTAGGTTTCTGCAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145453.2-927s21c1
Sequence:CCGGTGATACTAATTGGTACAATTGCTCGAGCAATTGTACCAATTAGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145453.2-905s21c1
Sequence:CCGGAGTACCCAAAGTTGTTAATTTCTCGAGAAATTAACAACTTTGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340505    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145453.2-1395s21c1
Sequence:CCGGGCCTTTCAGCTTGTGAATCAACTCGAGTTGATTCACAAGCTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145453.2-1044s21c1
Sequence:CCGGCCTTGGTAGCTTGCCTACAATCTCGAGATTGTAGGCAAGCTACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201138    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145453.1-1306s1c1
Sequence:CCGGCCTTTCAGCTTGTGAATCAAACTCGAGTTTGATTCACAAGCTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145453.1-960s1c1
Sequence:CCGGCCTTGGTAGCTTGCCTACAATCTCGAGATTGTAGGCAAGCTACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190681    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145453.1-1305s1c1
Sequence:CCGGGCCTTTCAGCTTGTGAATCAACTCGAGTTGATTCACAAGCTGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145453.1-138s1c1
Sequence:CCGGCAAATCGTAAGCAGTGTCAAACTCGAGTTTGACACTGCTTACGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145453.1-127s1c1
Sequence:CCGGCCAAAGCCTTCCAAATCGTAACTCGAGTTACGATTTGGAAGGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145453.1-400s1c1
Sequence:CCGGGAAGAATGCAATGGTGTGTTTCTCGAGAAACACACCATTGCATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145453
VALIDATED
ZCCHC9 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 9
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145453.2-928s1c1
Sequence:CCGGGATACTAATTGGTACAATTGTCTCGAGACAATTGTACCAATTAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145453.2-879s1c1
Sequence:CCGGCCCAAACTGCAGAAACCTAAACTCGAGTTTAGGTTTCTGCAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145453.2-927s21c1
Sequence:CCGGTGATACTAATTGGTACAATTGCTCGAGCAATTGTACCAATTAGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145453.2-905s21c1
Sequence:CCGGAGTACCCAAAGTTGTTAATTTCTCGAGAAATTAACAACTTTGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340505    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145453.2-1395s21c1
Sequence:CCGGGCCTTTCAGCTTGTGAATCAACTCGAGTTGATTCACAAGCTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145453.2-1044s21c1
Sequence:CCGGCCTTGGTAGCTTGCCTACAATCTCGAGATTGTAGGCAAGCTACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201138    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145453.1-1306s1c1
Sequence:CCGGCCTTTCAGCTTGTGAATCAAACTCGAGTTTGATTCACAAGCTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145453.1-960s1c1
Sequence:CCGGCCTTGGTAGCTTGCCTACAATCTCGAGATTGTAGGCAAGCTACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190681    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145453.1-1305s1c1
Sequence:CCGGGCCTTTCAGCTTGTGAATCAACTCGAGTTGATTCACAAGCTGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145453.1-138s1c1
Sequence:CCGGCAAATCGTAAGCAGTGTCAAACTCGAGTTTGACACTGCTTACGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145453.1-127s1c1
Sequence:CCGGCCAAAGCCTTCCAAATCGTAACTCGAGTTACGATTTGGAAGGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145453.1-400s1c1
Sequence:CCGGGAAGAATGCAATGGTGTGTTTCTCGAGAAACACACCATTGCATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks