EMAIL THIS PAGE TO A FRIEND

ZCRB1

zinc finger CCHC-type and RNA binding motif 1

Synonyms: MADP-1 MADP1 RBM36 SNRNP31 ZCCHC19
UniProtKB ID: Q8TBF4, Q6PJX0, Q96TA6
Gene ID:
Human(85437) Summary: Pre-mRNA splicing is catalyzed by the spliceosome. U12-type spliceosome binds U12-type pre-mRNAs and recognizes the 5' splice site and branch-point sequence. U11 and U12 snRNPs are components of U12-type spliceosome and function as a molecular bridge connecting both ends of the intron. The protein encoded by this gene contains a RNA recognition motif. It was identified as one of the protein components of U11/U12 snRNPs. This protein and many other U11/U12 snRNP proteins are highly conserved in organisms known to contain U12-type introns. These proteins have been shown to be essential for cell viability, suggesting the key roles in U12-type splicing. [provided by RefSeq, Jul 2008]
Mouse(67197) zinc finger CCHC-type and RNA binding motif 1
Rat(362990) zinc finger CCHC-type and RNA binding motif 1
Zebrafish(550251) zinc finger CCHC-type and RNA binding motif 1
chicken(417791) zinc finger CCHC-type and RNA binding motif 1
domestic cat(101098307) zinc finger CCHC-type and RNA binding motif 1
dog(477640) zinc finger CCHC-type and RNA binding motif 1
cow(504536) zinc finger CCHC-type and RNA binding motif 1
sheep(101116976) zinc finger CCHC-type and RNA binding motif 1
domestic guinea pig(100716105) zinc finger CCHC-type and RNA binding motif 1
naked mole-rat(101721975) zinc finger CCHC-type and RNA binding motif 1
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026025 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026025 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026025 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033114 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033114 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033114 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146861 MISSION® esiRNA esiRNA human ZCRB1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033114 Rosetta Predictions human pricing
NM_001034940 Rosetta Predictions rat pricing
NM_026025 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033114 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093634 predicted 233
2 SASI_Hs01_00093636 predicted 212
3 SASI_Hs01_00093638 predicted 209
4 SASI_Hs01_00093639 predicted 274
5 SASI_Hs01_00093640 predicted 227
6 SASI_Hs01_00093641 predicted 206
7 SASI_Hs01_00093642 predicted 216
8 SASI_Hs01_00093643 predicted 239
9 SASI_Hs02_00360832 predicted 274
10 SASI_Hs02_00360833 predicted 232
11 SASI_Hs01_00093635 predicted 304
12 SASI_Hs01_00093637 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034940 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041775 predicted 1071
2 SASI_Rn01_00041776 predicted 1042
3 SASI_Rn02_00204124 predicted 240
4 SASI_Rn01_00041777 predicted 914
5 SASI_Rn01_00041778 predicted 202
6 SASI_Rn01_00041779 predicted 888
7 SASI_Rn01_00041780 predicted 834
8 SASI_Rn01_00041781 predicted 1054
9 SASI_Rn02_00204125 predicted 1063
10 SASI_Rn01_00041782 predicted 885
11 SASI_Rn01_00041774 predicted 978
12 SASI_Rn01_00041783 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026025 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329498 predicted 228
2 SASI_Mm01_00031093 predicted 257
3 SASI_Mm01_00031094 predicted 246
4 SASI_Mm01_00031095 predicted 195
5 SASI_Mm01_00031096 predicted 221
6 SASI_Mm01_00031097 predicted 240
7 SASI_Mm01_00031098 predicted 215
8 SASI_Mm01_00031099 predicted 195
9 SASI_Mm01_00031101 predicted 255
10 SASI_Mm01_00031102 predicted 240
11 SASI_Mm01_00031100 predicted 239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026025
ZCRB1 MISSION shRNA Bacterial Glycerol Stock
zinc finger CCHC-type and RNA binding motif 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026025.1-567s1c1
Sequence:CCGGGAAGAAGAAATTGAGGAAGTACTCGAGTACTTCCTCAATTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026025.1-420s1c1
Sequence:CCGGCGGAGACGAAACTACTTTGATCTCGAGATCAAAGTAGTTTCGTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026025.1-382s1c1
Sequence:CCGGGCATCGCTATTGACAATGGAACTCGAGTTCCATTGTCAATAGCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026025.2-199s21c1
Sequence:CCGGCAATGATTTATACCGGATATTCTCGAGAATATCCGGTATAAATCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026025.2-424s21c1
Sequence:CCGGACGAAACTACTTTGATAAATCCTCGAGGATTTATCAAAGTAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026025.2-464s21c1
Sequence:CCGGGAAAGTGGACACTTAAGTTATCTCGAGATAACTTAAGTGTCCACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026025.2-276s21c1
Sequence:CCGGAGAGTAAAGGTGTTGCATTTACTCGAGTAAATGCAACACCTTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026025.2-371s21c1
Sequence:CCGGATAAAGGCGAGCATCGCTATTCTCGAGAATAGCGATGCTCGCCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026025
ZCRB1 MISSION shRNA shRNA Plasmid DNA
zinc finger CCHC-type and RNA binding motif 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026025.1-567s1c1
Sequence:CCGGGAAGAAGAAATTGAGGAAGTACTCGAGTACTTCCTCAATTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026025.1-420s1c1
Sequence:CCGGCGGAGACGAAACTACTTTGATCTCGAGATCAAAGTAGTTTCGTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026025.1-382s1c1
Sequence:CCGGGCATCGCTATTGACAATGGAACTCGAGTTCCATTGTCAATAGCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026025.2-199s21c1
Sequence:CCGGCAATGATTTATACCGGATATTCTCGAGAATATCCGGTATAAATCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026025.2-424s21c1
Sequence:CCGGACGAAACTACTTTGATAAATCCTCGAGGATTTATCAAAGTAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026025.2-464s21c1
Sequence:CCGGGAAAGTGGACACTTAAGTTATCTCGAGATAACTTAAGTGTCCACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026025.2-276s21c1
Sequence:CCGGAGAGTAAAGGTGTTGCATTTACTCGAGTAAATGCAACACCTTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026025.2-371s21c1
Sequence:CCGGATAAAGGCGAGCATCGCTATTCTCGAGAATAGCGATGCTCGCCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026025
ZCRB1 MISSION shRNA Lentiviral Transduction Particles
zinc finger CCHC-type and RNA binding motif 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026025.1-567s1c1
Sequence:CCGGGAAGAAGAAATTGAGGAAGTACTCGAGTACTTCCTCAATTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026025.1-420s1c1
Sequence:CCGGCGGAGACGAAACTACTTTGATCTCGAGATCAAAGTAGTTTCGTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026025.1-382s1c1
Sequence:CCGGGCATCGCTATTGACAATGGAACTCGAGTTCCATTGTCAATAGCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026025.2-199s21c1
Sequence:CCGGCAATGATTTATACCGGATATTCTCGAGAATATCCGGTATAAATCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026025.2-424s21c1
Sequence:CCGGACGAAACTACTTTGATAAATCCTCGAGGATTTATCAAAGTAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026025.2-464s21c1
Sequence:CCGGGAAAGTGGACACTTAAGTTATCTCGAGATAACTTAAGTGTCCACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026025.2-276s21c1
Sequence:CCGGAGAGTAAAGGTGTTGCATTTACTCGAGTAAATGCAACACCTTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026025.2-371s21c1
Sequence:CCGGATAAAGGCGAGCATCGCTATTCTCGAGAATAGCGATGCTCGCCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033114
VALIDATED
ZCRB1 MISSION shRNA Bacterial Glycerol Stock
zinc finger CCHC-type and RNA binding motif 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033114.2-473s1c1
Sequence:CCGGCGAAGGCGAAACTACTTTGATCTCGAGATCAAAGTAGTTTCGCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033114.2-435s1c1
Sequence:CCGGGCATTGCTATTGACAATGGAACTCGAGTTCCATTGTCAATAGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033114.2-253s1c1
Sequence:CCGGCAATGACTTGTACCGGATATTCTCGAGAATATCCGGTACAAGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033114.2-310s1c1
Sequence:CCGGGAAAGATAAAGATACCAGGAACTCGAGTTCCTGGTATCTTTATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033114.2-277s1c1
Sequence:CCGGCAAGTATGGCAAAGTTGTAAACTCGAGTTTACAACTTTGCCATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033114.2-815s1c1
Sequence:CCGGGATGAGGAAGAACTTAGTGATCTCGAGATCACTAAGTTCTTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033114.3-498s21c1
Sequence:CCGGCGAAGGCGAAACTACTTTGATCTCGAGATCAAAGTAGTTTCGCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033114.3-460s21c1
Sequence:CCGGGCATTGCTATTGACAATGGAACTCGAGTTCCATTGTCAATAGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033114.3-278s21c1
Sequence:CCGGCAATGACTTGTACCGGATATTCTCGAGAATATCCGGTACAAGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033114.3-840s21c1
Sequence:CCGGGATGAGGAAGAACTTAGTGATCTCGAGATCACTAAGTTCTTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033114
VALIDATED
ZCRB1 MISSION shRNA shRNA Plasmid DNA
zinc finger CCHC-type and RNA binding motif 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033114.2-473s1c1
Sequence:CCGGCGAAGGCGAAACTACTTTGATCTCGAGATCAAAGTAGTTTCGCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033114.2-435s1c1
Sequence:CCGGGCATTGCTATTGACAATGGAACTCGAGTTCCATTGTCAATAGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033114.2-253s1c1
Sequence:CCGGCAATGACTTGTACCGGATATTCTCGAGAATATCCGGTACAAGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033114.2-310s1c1
Sequence:CCGGGAAAGATAAAGATACCAGGAACTCGAGTTCCTGGTATCTTTATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033114.2-277s1c1
Sequence:CCGGCAAGTATGGCAAAGTTGTAAACTCGAGTTTACAACTTTGCCATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033114.2-815s1c1
Sequence:CCGGGATGAGGAAGAACTTAGTGATCTCGAGATCACTAAGTTCTTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033114.3-498s21c1
Sequence:CCGGCGAAGGCGAAACTACTTTGATCTCGAGATCAAAGTAGTTTCGCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033114.3-460s21c1
Sequence:CCGGGCATTGCTATTGACAATGGAACTCGAGTTCCATTGTCAATAGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033114.3-278s21c1
Sequence:CCGGCAATGACTTGTACCGGATATTCTCGAGAATATCCGGTACAAGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033114.3-840s21c1
Sequence:CCGGGATGAGGAAGAACTTAGTGATCTCGAGATCACTAAGTTCTTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033114
VALIDATED
ZCRB1 MISSION shRNA Lentiviral Transduction Particles
zinc finger CCHC-type and RNA binding motif 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033114.2-473s1c1
Sequence:CCGGCGAAGGCGAAACTACTTTGATCTCGAGATCAAAGTAGTTTCGCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033114.2-435s1c1
Sequence:CCGGGCATTGCTATTGACAATGGAACTCGAGTTCCATTGTCAATAGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033114.2-253s1c1
Sequence:CCGGCAATGACTTGTACCGGATATTCTCGAGAATATCCGGTACAAGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033114.2-310s1c1
Sequence:CCGGGAAAGATAAAGATACCAGGAACTCGAGTTCCTGGTATCTTTATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033114.2-277s1c1
Sequence:CCGGCAAGTATGGCAAAGTTGTAAACTCGAGTTTACAACTTTGCCATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033114.2-815s1c1
Sequence:CCGGGATGAGGAAGAACTTAGTGATCTCGAGATCACTAAGTTCTTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033114.3-498s21c1
Sequence:CCGGCGAAGGCGAAACTACTTTGATCTCGAGATCAAAGTAGTTTCGCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033114.3-460s21c1
Sequence:CCGGGCATTGCTATTGACAATGGAACTCGAGTTCCATTGTCAATAGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033114.3-278s21c1
Sequence:CCGGCAATGACTTGTACCGGATATTCTCGAGAATATCCGGTACAAGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033114.3-840s21c1
Sequence:CCGGGATGAGGAAGAACTTAGTGATCTCGAGATCACTAAGTTCTTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks