EMAIL THIS PAGE TO A FRIEND

ZCWPW1

zinc finger, CW type with PWWP domain 1

Synonyms: ZCW1
UniProtKB ID: Q9H0M4, A8MVF5, B4DUQ2, Q8NA98, Q9BUD0, Q9NWF7
Gene ID:
Mouse(381678) zinc finger, CW type with PWWP domain 1
Rat(304368) zinc finger, CW-type with PWWP domain 1
Horse(100068927) zinc finger, CW type with PWWP domain 1
dog(489840) zinc finger, CW type with PWWP domain 1
domestic cat(101099676) zinc finger, CW type with PWWP domain 1
naked mole-rat(101720608) zinc finger, CW type with PWWP domain 1
Domestic Rabbit(100339809) zinc finger, CW type with PWWP domain 1
domestic guinea pig(100715413) zinc finger, CW type with PWWP domain 1
cow(514550) zinc finger, CW type with PWWP domain 1
sheep(101106228) zinc finger, CW type with PWWP domain 1
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017984 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017984 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017984 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001005426 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001005426 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001005426 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017984 Rosetta Predictions human pricing
XM_001076305 Rosetta Predictions rat pricing
XM_222057 Rosetta Predictions rat pricing
NM_001005426 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017984 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052078 predicted 784
2 SASI_Hs01_00052079 predicted 1078
3 SASI_Hs01_00052080 predicted 1113
4 SASI_Hs02_00351024 predicted 1112
5 SASI_Hs01_00052081 predicted 2096
6 SASI_Hs01_00052082 predicted 1936
7 SASI_Hs02_00351025 predicted 781
8 SASI_Hs01_00052083 predicted 1069
9 SASI_Hs01_00052084 predicted 1339
10 SASI_Hs01_00052085 predicted 252
11 SASI_Hs01_00052086 predicted 1206
12 SASI_Hs01_00052087 predicted 1320
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076305 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352779 predicted 1996
2 SASI_Rn02_00352780 predicted 1119
3 SASI_Rn02_00352781 predicted 1119
4 SASI_Rn02_00352782 predicted 375
5 SASI_Rn02_00352783 predicted 413
6 SASI_Rn02_00352784 predicted 729
7 SASI_Rn02_00352785 predicted 667
8 SASI_Rn02_00352786 predicted 1977
9 SASI_Rn02_00352787 predicted 957
10 SASI_Rn02_00352788 predicted 942
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222057 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380542 predicted 979
2 SASI_Rn02_00380543 predicted 1015
3 SASI_Rn02_00380544 predicted 1625
4 SASI_Rn02_00380545 predicted 1011
5 SASI_Rn02_00380546 predicted 1739
6 SASI_Rn02_00380547 predicted 977
7 SASI_Rn02_00380548 predicted 1751
8 SASI_Rn02_00380549 predicted 959
9 SASI_Rn02_00380550 predicted 1000
10 SASI_Rn02_00380551 predicted 1794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005426 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286593 predicted 1724
2 SASI_Mm01_00107526 predicted 502
3 SASI_Mm01_00107527 predicted 924
4 SASI_Mm01_00107528 predicted 1134
5 SASI_Mm01_00107529 predicted 1130
6 SASI_Mm02_00286594 predicted 1101
7 SASI_Mm01_00107530 predicted 559
8 SASI_Mm01_00107531 predicted 370
9 SASI_Mm02_00286595 predicted 471
10 SASI_Mm01_00107533 predicted 922
11 SASI_Mm01_00107532 predicted 374
12 SASI_Mm01_00107534 predicted 1713
13 SASI_Mm01_00107535 predicted 1041
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017984
ZCWPW1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CW type with PWWP domain 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017984.3-700s21c1
Sequence:CCGGCTGCTACTGATACTGATAATGCTCGAGCATTATCAGTATCAGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017984.3-1491s21c1
Sequence:CCGGAGCATTCAGGAACGGGTTAACCTCGAGGTTAACCCGTTCCTGAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017984.3-787s21c1
Sequence:CCGGAGATAAGGACATCTAAGTTAGCTCGAGCTAACTTAGATGTCCTTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017984.2-836s1c1
Sequence:CCGGGAAATCCAATAGACTCACCTTCTCGAGAAGGTGAGTCTATTGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017984.2-410s1c1
Sequence:CCGGCCTGCCAAAGGCCAGTTTAAACTCGAGTTTAAACTGGCCTTTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017984.2-1671s1c1
Sequence:CCGGCCCATTCGTAAGCGAGTCAAACTCGAGTTTGACTCGCTTACGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017984.2-654s1c1
Sequence:CCGGCCCGTAGTATCTACCCAATCACTCGAGTGATTGGGTAGATACTACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139194    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017984.2-2089s1c1
Sequence:CCGGCTGGAGCAACTCATGGAAGATCTCGAGATCTTCCATGAGTTGCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017984.2-1514s1c1
Sequence:CCGGGTTTGGTTTCTGGAGCCGATTCTCGAGAATCGGCTCCAGAAACCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017984
ZCWPW1 MISSION shRNA shRNA Plasmid DNA
zinc finger, CW type with PWWP domain 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017984.3-700s21c1
Sequence:CCGGCTGCTACTGATACTGATAATGCTCGAGCATTATCAGTATCAGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017984.3-1491s21c1
Sequence:CCGGAGCATTCAGGAACGGGTTAACCTCGAGGTTAACCCGTTCCTGAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017984.3-787s21c1
Sequence:CCGGAGATAAGGACATCTAAGTTAGCTCGAGCTAACTTAGATGTCCTTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017984.2-836s1c1
Sequence:CCGGGAAATCCAATAGACTCACCTTCTCGAGAAGGTGAGTCTATTGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017984.2-410s1c1
Sequence:CCGGCCTGCCAAAGGCCAGTTTAAACTCGAGTTTAAACTGGCCTTTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017984.2-1671s1c1
Sequence:CCGGCCCATTCGTAAGCGAGTCAAACTCGAGTTTGACTCGCTTACGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017984.2-654s1c1
Sequence:CCGGCCCGTAGTATCTACCCAATCACTCGAGTGATTGGGTAGATACTACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139194    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017984.2-2089s1c1
Sequence:CCGGCTGGAGCAACTCATGGAAGATCTCGAGATCTTCCATGAGTTGCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017984.2-1514s1c1
Sequence:CCGGGTTTGGTTTCTGGAGCCGATTCTCGAGAATCGGCTCCAGAAACCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017984
ZCWPW1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CW type with PWWP domain 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017984.3-700s21c1
Sequence:CCGGCTGCTACTGATACTGATAATGCTCGAGCATTATCAGTATCAGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017984.3-1491s21c1
Sequence:CCGGAGCATTCAGGAACGGGTTAACCTCGAGGTTAACCCGTTCCTGAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017984.3-787s21c1
Sequence:CCGGAGATAAGGACATCTAAGTTAGCTCGAGCTAACTTAGATGTCCTTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017984.2-836s1c1
Sequence:CCGGGAAATCCAATAGACTCACCTTCTCGAGAAGGTGAGTCTATTGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017984.2-410s1c1
Sequence:CCGGCCTGCCAAAGGCCAGTTTAAACTCGAGTTTAAACTGGCCTTTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017984.2-1671s1c1
Sequence:CCGGCCCATTCGTAAGCGAGTCAAACTCGAGTTTGACTCGCTTACGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017984.2-654s1c1
Sequence:CCGGCCCGTAGTATCTACCCAATCACTCGAGTGATTGGGTAGATACTACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139194    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017984.2-2089s1c1
Sequence:CCGGCTGGAGCAACTCATGGAAGATCTCGAGATCTTCCATGAGTTGCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017984.2-1514s1c1
Sequence:CCGGGTTTGGTTTCTGGAGCCGATTCTCGAGAATCGGCTCCAGAAACCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005426
ZCWPW1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CW type with PWWP domain 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005426.1-930s1c1
Sequence:CCGGCAGAATCCAGATCCGAATTATCTCGAGATAATTCGGATCTGGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005426.1-930s21c1
Sequence:CCGGCAGAATCCAGATCCGAATTATCTCGAGATAATTCGGATCTGGATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005426.1-1137s21c1
Sequence:CCGGTCTAAGTACCACGTGACATTTCTCGAGAAATGTCACGTGGTACTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005426.1-2024s21c1
Sequence:CCGGCAGGGAGAGCCTCTCATTTCTCTCGAGAGAAATGAGAGGCTCTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005426.1-1711s21c1
Sequence:CCGGAGACTTCAGCCACCAACTTATCTCGAGATAAGTTGGTGGCTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005426.1-1135s1c1
Sequence:CCGGCGTCTAAGTACCACGTGACATCTCGAGATGTCACGTGGTACTTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005426.1-376s1c1
Sequence:CCGGGAACTCTTACCAGTGCAGAATCTCGAGATTCTGCACTGGTAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005426
ZCWPW1 MISSION shRNA shRNA Plasmid DNA
zinc finger, CW type with PWWP domain 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005426.1-930s1c1
Sequence:CCGGCAGAATCCAGATCCGAATTATCTCGAGATAATTCGGATCTGGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005426.1-930s21c1
Sequence:CCGGCAGAATCCAGATCCGAATTATCTCGAGATAATTCGGATCTGGATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005426.1-1137s21c1
Sequence:CCGGTCTAAGTACCACGTGACATTTCTCGAGAAATGTCACGTGGTACTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005426.1-2024s21c1
Sequence:CCGGCAGGGAGAGCCTCTCATTTCTCTCGAGAGAAATGAGAGGCTCTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005426.1-1711s21c1
Sequence:CCGGAGACTTCAGCCACCAACTTATCTCGAGATAAGTTGGTGGCTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005426.1-1135s1c1
Sequence:CCGGCGTCTAAGTACCACGTGACATCTCGAGATGTCACGTGGTACTTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005426.1-376s1c1
Sequence:CCGGGAACTCTTACCAGTGCAGAATCTCGAGATTCTGCACTGGTAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005426
ZCWPW1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CW type with PWWP domain 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005426.1-930s1c1
Sequence:CCGGCAGAATCCAGATCCGAATTATCTCGAGATAATTCGGATCTGGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005426.1-930s21c1
Sequence:CCGGCAGAATCCAGATCCGAATTATCTCGAGATAATTCGGATCTGGATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005426.1-1137s21c1
Sequence:CCGGTCTAAGTACCACGTGACATTTCTCGAGAAATGTCACGTGGTACTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005426.1-2024s21c1
Sequence:CCGGCAGGGAGAGCCTCTCATTTCTCTCGAGAGAAATGAGAGGCTCTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005426.1-1711s21c1
Sequence:CCGGAGACTTCAGCCACCAACTTATCTCGAGATAAGTTGGTGGCTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005426.1-1135s1c1
Sequence:CCGGCGTCTAAGTACCACGTGACATCTCGAGATGTCACGTGGTACTTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005426.1-376s1c1
Sequence:CCGGGAACTCTTACCAGTGCAGAATCTCGAGATTCTGCACTGGTAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks