EMAIL THIS PAGE TO A FRIEND

ZCWPW2

zinc finger, CW type with PWWP domain 2

Synonyms: ZCW2
UniProtKB ID: Q504Y3
Gene ID:
Mouse(100039681) zinc finger, CW type with PWWP domain 2
Rat(681381) zinc finger, CW type with PWWP domain 2
cow(789632) zinc finger, CW type with PWWP domain 2
sheep(101109307) zinc finger, CW type with PWWP domain 2
naked mole-rat(101701426) zinc finger, CW type with PWWP domain 2
domestic cat(101090459) zinc finger, CW type with PWWP domain 2
dog(100682830) zinc finger, CW type with PWWP domain 2
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040432 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040432 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040432 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103131 MISSION® esiRNA esiRNA human ZCWPW2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040432 Rosetta Predictions human pricing
XM_001061491 Rosetta Predictions rat pricing
XM_001473321 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040432 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050702 predicted 1151
2 SASI_Hs01_00050704 predicted 615
3 SASI_Hs01_00050705 predicted 321
4 SASI_Hs01_00050706 predicted 396
5 SASI_Hs01_00050707 predicted 292
6 SASI_Hs01_00050708 predicted 1095
7 SASI_Hs01_00050709 predicted 590
8 SASI_Hs01_00050710 predicted 401
9 SASI_Hs01_00050711 predicted 525
10 SASI_Hs02_00308959 predicted 302
11 SASI_Hs01_00050703 predicted 1159
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061491 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300284 predicted 229
2 SASI_Rn02_00300285 predicted 361
3 SASI_Rn02_00300286 predicted 225
4 SASI_Rn02_00300287 predicted 229
5 SASI_Rn02_00300288 predicted 307
6 SASI_Rn02_00300289 predicted 363
7 SASI_Rn02_00300290 predicted 357
8 SASI_Rn02_00300291 predicted 222
9 SASI_Rn02_00300292 predicted 221
10 SASI_Rn02_00300293 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001473321 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00367413 predicted 337
2 SASI_Mm02_00367414 predicted 548
3 SASI_Mm02_00367415 predicted 280
4 SASI_Mm02_00367416 predicted 312
5 SASI_Mm02_00367417 predicted 390
6 SASI_Mm02_00367418 predicted 209
7 SASI_Mm02_00367419 predicted 690
8 SASI_Mm02_00367420 predicted 558
9 SASI_Mm02_00367421 predicted 724
10 SASI_Mm02_00367422 predicted 506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040432
ZCWPW2 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CW type with PWWP domain 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000246030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040432.1-688s21c1
Sequence:CCGGATGTCTACTCTATGGATATTCCTCGAGGAATATCCATAGAGTAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040432.1-1149s21c1
Sequence:CCGGGAGAATGTATTGAGGATATAACTCGAGTTATATCCTCAATACATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040432.1-1554s21c1
Sequence:CCGGTGGCTGGCCAAGCTATTATAACTCGAGTTATAATAGCTTGGCCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040432.1-611s21c1
Sequence:CCGGGGACATTATAGTATCACATTACTCGAGTAATGTGATACTATAATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040432
ZCWPW2 MISSION shRNA shRNA Plasmid DNA
zinc finger, CW type with PWWP domain 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000246030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040432.1-688s21c1
Sequence:CCGGATGTCTACTCTATGGATATTCCTCGAGGAATATCCATAGAGTAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040432.1-1149s21c1
Sequence:CCGGGAGAATGTATTGAGGATATAACTCGAGTTATATCCTCAATACATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040432.1-1554s21c1
Sequence:CCGGTGGCTGGCCAAGCTATTATAACTCGAGTTATAATAGCTTGGCCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040432.1-611s21c1
Sequence:CCGGGGACATTATAGTATCACATTACTCGAGTAATGTGATACTATAATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040432
ZCWPW2 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CW type with PWWP domain 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000246030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040432.1-688s21c1
Sequence:CCGGATGTCTACTCTATGGATATTCCTCGAGGAATATCCATAGAGTAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040432.1-1149s21c1
Sequence:CCGGGAGAATGTATTGAGGATATAACTCGAGTTATATCCTCAATACATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040432.1-1554s21c1
Sequence:CCGGTGGCTGGCCAAGCTATTATAACTCGAGTTATAATAGCTTGGCCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040432.1-611s21c1
Sequence:CCGGGGACATTATAGTATCACATTACTCGAGTAATGTGATACTATAATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks