EMAIL THIS PAGE TO A FRIEND

ZDBF2

zinc finger, DBF-type containing 2

UniProtKB ID: Q9HCK1, Q6ZNP7, Q6ZSN8
Gene ID:
Mouse(73884) zinc finger, DBF-type containing 2
Rat(501153) zinc finger, DBF-type containing 2
chicken(424100) zinc finger, DBF-type containing 2
Horse(100068542) zinc finger, DBF-type containing 2
domestic cat(101089789) zinc finger, DBF-type containing 2
dog(488490) zinc finger, DBF-type containing 2
naked mole-rat(101697867) zinc finger, DBF-type containing 2
Domestic Rabbit(100354684) zinc finger, DBF-type containing 2
domestic guinea pig(100716937) zinc finger, DBF-type containing 2
cow(100139725) zinc finger, DBF-type containing 2
sheep(101105062) zinc finger, DBF-type containing 2
132 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028673 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028673 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028673 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020923 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020923 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020923 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020923 Rosetta Predictions human pricing
XM_371590 Rosetta Predictions human pricing
XM_576579 Rosetta Predictions rat pricing
XM_908801 Rosetta Predictions mouse pricing
XM_991644 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354296 predicted 3890
2 SASI_Hs02_00354297 predicted 6352
3 SASI_Hs02_00354298 predicted 6875
4 SASI_Hs02_00354299 predicted 4472
5 SASI_Hs02_00354300 predicted 3501
6 SASI_Hs02_00354301 predicted 814
7 SASI_Hs02_00354302 predicted 3707
8 SASI_Hs02_00354303 predicted 4725
9 SASI_Hs02_00354304 predicted 849
10 SASI_Hs02_00354305 predicted 2106
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00294160 predicted 3897
2 SASI_Hs01_00294161 predicted 6350
3 SASI_Hs01_00294162 predicted 6875
4 SASI_Hs01_00294163 predicted 3504
5 SASI_Hs01_00294164 predicted 5143
6 SASI_Hs01_00294165 predicted 822
7 SASI_Hs01_00294166 predicted 2070
8 SASI_Hs01_00294167 predicted 851
9 SASI_Hs01_00294168 predicted 2109
10 SASI_Hs01_00294169 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576579 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405577 predicted 903
2 SASI_Rn02_00405578 predicted 5456
3 SASI_Rn02_00405579 predicted 721
4 SASI_Rn02_00405580 predicted 2554
5 SASI_Rn02_00405581 predicted 5241
6 SASI_Rn02_00405582 predicted 6539
7 SASI_Rn02_00405583 predicted 2517
8 SASI_Rn02_00405584 predicted 1901
9 SASI_Rn02_00405585 predicted 4138
10 SASI_Rn02_00405586 predicted 3356
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_908801 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00434394 predicted 6777
2 SASI_Mm02_00434395 predicted 3589
3 SASI_Mm02_00434396 predicted 1052
4 SASI_Mm02_00434397 predicted 1660
5 SASI_Mm02_00434398 predicted 5121
6 SASI_Mm02_00434399 predicted 1136
7 SASI_Mm02_00434400 predicted 4782
8 SASI_Mm02_00434401 predicted 2820
9 SASI_Mm02_00434402 predicted 4088
10 SASI_Mm02_00434403 predicted 5018
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_991644 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00261787 predicted 3582
2 SASI_Mm02_00450830 predicted 6348
3 SASI_Mm01_00261788 predicted 1052
4 SASI_Mm01_00261789 predicted 1651
5 SASI_Mm01_00261790 predicted 5125
6 SASI_Mm01_00261791 predicted 1141
7 SASI_Mm01_00261792 predicted 4777
8 SASI_Mm01_00261793 predicted 2820
9 SASI_Mm01_00261794 predicted 4085
10 SASI_Mm02_00450831 predicted 5015
11 SASI_Mm01_00261795 predicted 3283
12 SASI_Mm01_00261796 predicted 1823
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028673
ZDBF2 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DBF-type containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028673.1-599s21c1
Sequence:CCGGACGTCGGACAGCTACTAATAACTCGAGTTATTAGTAGCTGTCCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028673.1-3652s21c1
Sequence:CCGGTTAGAGGGATGGCCGTAAATGCTCGAGCATTTACGGCCATCCCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028673.1-6453s21c1
Sequence:CCGGCCCGATTCCTTGGTCTATATTCTCGAGAATATAGACCAAGGAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028673.1-8196s21c1
Sequence:CCGGAGCAACCTTTGTCCCATTTATCTCGAGATAAATGGGACAAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028673.1-651s21c1
Sequence:CCGGCTGCGACACCACCCATATAATCTCGAGATTATATGGGTGGTGTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028673
ZDBF2 MISSION shRNA shRNA Plasmid DNA
zinc finger, DBF-type containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028673.1-599s21c1
Sequence:CCGGACGTCGGACAGCTACTAATAACTCGAGTTATTAGTAGCTGTCCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028673.1-3652s21c1
Sequence:CCGGTTAGAGGGATGGCCGTAAATGCTCGAGCATTTACGGCCATCCCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028673.1-6453s21c1
Sequence:CCGGCCCGATTCCTTGGTCTATATTCTCGAGAATATAGACCAAGGAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028673.1-8196s21c1
Sequence:CCGGAGCAACCTTTGTCCCATTTATCTCGAGATAAATGGGACAAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028673.1-651s21c1
Sequence:CCGGCTGCGACACCACCCATATAATCTCGAGATTATATGGGTGGTGTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028673
ZDBF2 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DBF-type containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028673.1-599s21c1
Sequence:CCGGACGTCGGACAGCTACTAATAACTCGAGTTATTAGTAGCTGTCCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028673.1-3652s21c1
Sequence:CCGGTTAGAGGGATGGCCGTAAATGCTCGAGCATTTACGGCCATCCCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028673.1-6453s21c1
Sequence:CCGGCCCGATTCCTTGGTCTATATTCTCGAGAATATAGACCAAGGAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028673.1-8196s21c1
Sequence:CCGGAGCAACCTTTGTCCCATTTATCTCGAGATAAATGGGACAAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028673.1-651s21c1
Sequence:CCGGCTGCGACACCACCCATATAATCTCGAGATTATATGGGTGGTGTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020923
VALIDATED
ZDBF2 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DBF-type containing 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020923.1-5213s21c1
Sequence:CCGGGATAAGAGCTGTGGATATAATCTCGAGATTATATCCACAGCTCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020923.1-9062s21c1
Sequence:CCGGTAGTTGCAAAGCAGCATATATCTCGAGATATATGCTGCTTTGCAACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020923.1-1166s21c1
Sequence:CCGGTTAGCAGTAAACCCGAATAAACTCGAGTTTATTCGGGTTTACTGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020923.1-3637s21c1
Sequence:CCGGTCAACCCAAAGTAGCTATTAACTCGAGTTAATAGCTACTTTGGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020923.1-6355s21c1
Sequence:CCGGGGATAATGATATTCGGTTTATCTCGAGATAAACCGAATATCATTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020923
VALIDATED
ZDBF2 MISSION shRNA shRNA Plasmid DNA
zinc finger, DBF-type containing 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020923.1-5213s21c1
Sequence:CCGGGATAAGAGCTGTGGATATAATCTCGAGATTATATCCACAGCTCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020923.1-9062s21c1
Sequence:CCGGTAGTTGCAAAGCAGCATATATCTCGAGATATATGCTGCTTTGCAACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020923.1-1166s21c1
Sequence:CCGGTTAGCAGTAAACCCGAATAAACTCGAGTTTATTCGGGTTTACTGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020923.1-3637s21c1
Sequence:CCGGTCAACCCAAAGTAGCTATTAACTCGAGTTAATAGCTACTTTGGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020923.1-6355s21c1
Sequence:CCGGGGATAATGATATTCGGTTTATCTCGAGATAAACCGAATATCATTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020923
VALIDATED
ZDBF2 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DBF-type containing 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020923.1-5213s21c1
Sequence:CCGGGATAAGAGCTGTGGATATAATCTCGAGATTATATCCACAGCTCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020923.1-9062s21c1
Sequence:CCGGTAGTTGCAAAGCAGCATATATCTCGAGATATATGCTGCTTTGCAACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020923.1-1166s21c1
Sequence:CCGGTTAGCAGTAAACCCGAATAAACTCGAGTTTATTCGGGTTTACTGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020923.1-3637s21c1
Sequence:CCGGTCAACCCAAAGTAGCTATTAACTCGAGTTAATAGCTACTTTGGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020923.1-6355s21c1
Sequence:CCGGGGATAATGATATTCGGTTTATCTCGAGATAAACCGAATATCATTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks