EMAIL THIS PAGE TO A FRIEND

ZDHHC11

zinc finger, DHHC-type containing 11

Synonyms: ZNF399
UniProtKB ID: Q9H8X9
Gene ID:
Mouse(71164) zinc finger, DHHC domain containing 11
Rat(499000) zinc finger, DHHC-type containing 11
domestic cat(101081959) zinc finger, DHHC-type containing 11
naked mole-rat(101704315) zinc finger, DHHC-type containing 11
domestic guinea pig(100733840) zinc finger, DHHC-type containing 11
cow(617224) zinc finger, DHHC-type containing 11
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024786 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024786 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024786 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027704 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027704 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027704 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024786 Rosetta Predictions human pricing
NM_001039342 Rosetta Predictions rat pricing
XM_001060295 Rosetta Predictions rat pricing
NM_027704 Rosetta Predictions mouse pricing
XM_127421 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024786 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204381 predicted 1678
2 SASI_Hs02_00357330 predicted 1456
3 SASI_Hs02_00357331 predicted 1677
4 SASI_Hs02_00357332 predicted 1408
5 SASI_Hs02_00357333 predicted 1351
6 SASI_Hs01_00204382 predicted 1000
7 SASI_Hs01_00204383 predicted 1174
8 SASI_Hs01_00204384 predicted 1189
9 SASI_Hs01_00204385 predicted 1272
10 SASI_Hs01_00204386 predicted 1247
11 SASI_Hs01_00204387 predicted 1360
12 SASI_Hs01_00204388 predicted 674
13 SASI_Hs01_00204389 predicted 1215
14 SASI_Hs01_00204390 predicted 1186
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039342 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089442 predicted 516
2 SASI_Rn01_00089443 predicted 418
3 SASI_Rn01_00089444 predicted 534
4 SASI_Rn01_00089445 predicted 391
5 SASI_Rn01_00089446 predicted 229
6 SASI_Rn02_00204823 predicted 511
7 SASI_Rn02_00204824 predicted 1133
8 SASI_Rn01_00089447 predicted 244
9 SASI_Rn02_00204825 predicted 841
10 SASI_Rn02_00204826 predicted 826
11 SASI_Rn01_00089441 predicted 366
12 SASI_Rn01_00089448 predicted 224
13 SASI_Rn01_00089449 predicted 341
14 SASI_Rn01_00089450 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060295 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295935 predicted 610
2 SASI_Rn02_00295936 predicted 347
3 SASI_Rn02_00295937 predicted 508
4 SASI_Rn02_00295938 predicted 428
5 SASI_Rn02_00295939 predicted 441
6 SASI_Rn02_00295940 predicted 381
7 SASI_Rn02_00295941 predicted 398
8 SASI_Rn02_00295942 predicted 245
9 SASI_Rn02_00295943 predicted 579
10 SASI_Rn02_00295944 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027704 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332599 predicted 267
2 SASI_Mm02_00332600 predicted 601
3 SASI_Mm02_00332601 predicted 1024
4 SASI_Mm02_00332602 predicted 1010
5 SASI_Mm02_00332603 predicted 509
6 SASI_Mm02_00332604 predicted 839
7 SASI_Mm02_00332605 predicted 849
8 SASI_Mm02_00332606 predicted 321
9 SASI_Mm02_00332607 predicted 351
10 SASI_Mm02_00332608 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127421 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266007 predicted 847
2 SASI_Mm01_00266008 predicted 861
3 SASI_Mm01_00266009 predicted 793
4 SASI_Mm01_00266010 predicted 652
5 SASI_Mm01_00266011 predicted 820
6 SASI_Mm01_00266012 predicted 845
7 SASI_Mm01_00266013 predicted 682
8 SASI_Mm01_00266014 predicted 800
9 SASI_Mm01_00266015 predicted 821
10 SASI_Mm01_00266016 predicted 678
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024786
VALIDATED
ZDHHC11 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 11
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024786.1-1576s1c1
Sequence:CCGGGAAACAACAGAGCCCATGAAACTCGAGTTTCATGGGCTCTGTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024786.1-1245s1c1
Sequence:CCGGGAAAGATCCATACGTGCAAATCTCGAGATTTGCACGTATGGATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024786.1-1184s1c1
Sequence:CCGGCCACCTTTGAGTATCTCATTACTCGAGTAATGAGATACTCAAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_024786.1-675s1c1
Sequence:CCGGCTCCAATGTCAGACTCATGAACTCGAGTTCATGAGTCTGACATTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024786.1-875s1c1
Sequence:CCGGGCCGGAATTATTGGTTCTTCTCTCGAGAGAAGAACCAATAATTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024786.1-840s1c1
Sequence:CCGGCCACCACTGCAAATGGATCAACTCGAGTTGATCCATTTGCAGTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024786.1-843s1c1
Sequence:CCGGCCACTGCAAATGGATCAACAACTCGAGTTGTTGATCCATTTGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024786.1-2356s21c1
Sequence:CCGGGAGTTCACAGTACTCGGAAATCTCGAGATTTCCGAGTACTGTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024786.1-1349s21c1
Sequence:CCGGACAAGCACTTATGTCACTTCTCTCGAGAGAAGTGACATAAGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024786.1-1485s21c1
Sequence:CCGGTCAGTTCTCCACTCGTGTACACTCGAGTGTACACGAGTGGAGAACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024786.1-1414s21c1
Sequence:CCGGGATGAAGACCCGTGTCCATCTCTCGAGAGATGGACACGGGTCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024786.1-1338s21c1
Sequence:CCGGCCTGCTGATTCACAAGCACTTCTCGAGAAGTGCTTGTGAATCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024786
VALIDATED
ZDHHC11 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 11
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024786.1-1576s1c1
Sequence:CCGGGAAACAACAGAGCCCATGAAACTCGAGTTTCATGGGCTCTGTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024786.1-1245s1c1
Sequence:CCGGGAAAGATCCATACGTGCAAATCTCGAGATTTGCACGTATGGATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024786.1-1184s1c1
Sequence:CCGGCCACCTTTGAGTATCTCATTACTCGAGTAATGAGATACTCAAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_024786.1-675s1c1
Sequence:CCGGCTCCAATGTCAGACTCATGAACTCGAGTTCATGAGTCTGACATTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024786.1-875s1c1
Sequence:CCGGGCCGGAATTATTGGTTCTTCTCTCGAGAGAAGAACCAATAATTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024786.1-840s1c1
Sequence:CCGGCCACCACTGCAAATGGATCAACTCGAGTTGATCCATTTGCAGTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024786.1-843s1c1
Sequence:CCGGCCACTGCAAATGGATCAACAACTCGAGTTGTTGATCCATTTGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024786.1-2356s21c1
Sequence:CCGGGAGTTCACAGTACTCGGAAATCTCGAGATTTCCGAGTACTGTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024786.1-1349s21c1
Sequence:CCGGACAAGCACTTATGTCACTTCTCTCGAGAGAAGTGACATAAGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024786.1-1485s21c1
Sequence:CCGGTCAGTTCTCCACTCGTGTACACTCGAGTGTACACGAGTGGAGAACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024786.1-1414s21c1
Sequence:CCGGGATGAAGACCCGTGTCCATCTCTCGAGAGATGGACACGGGTCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024786.1-1338s21c1
Sequence:CCGGCCTGCTGATTCACAAGCACTTCTCGAGAAGTGCTTGTGAATCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024786
VALIDATED
ZDHHC11 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 11
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024786.1-1576s1c1
Sequence:CCGGGAAACAACAGAGCCCATGAAACTCGAGTTTCATGGGCTCTGTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024786.1-1245s1c1
Sequence:CCGGGAAAGATCCATACGTGCAAATCTCGAGATTTGCACGTATGGATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024786.1-1184s1c1
Sequence:CCGGCCACCTTTGAGTATCTCATTACTCGAGTAATGAGATACTCAAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_024786.1-675s1c1
Sequence:CCGGCTCCAATGTCAGACTCATGAACTCGAGTTCATGAGTCTGACATTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024786.1-875s1c1
Sequence:CCGGGCCGGAATTATTGGTTCTTCTCTCGAGAGAAGAACCAATAATTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024786.1-840s1c1
Sequence:CCGGCCACCACTGCAAATGGATCAACTCGAGTTGATCCATTTGCAGTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024786.1-843s1c1
Sequence:CCGGCCACTGCAAATGGATCAACAACTCGAGTTGTTGATCCATTTGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024786.1-2356s21c1
Sequence:CCGGGAGTTCACAGTACTCGGAAATCTCGAGATTTCCGAGTACTGTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024786.1-1349s21c1
Sequence:CCGGACAAGCACTTATGTCACTTCTCTCGAGAGAAGTGACATAAGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024786.1-1485s21c1
Sequence:CCGGTCAGTTCTCCACTCGTGTACACTCGAGTGTACACGAGTGGAGAACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024786.1-1414s21c1
Sequence:CCGGGATGAAGACCCGTGTCCATCTCTCGAGAGATGGACACGGGTCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024786.1-1338s21c1
Sequence:CCGGCCTGCTGATTCACAAGCACTTCTCGAGAAGTGCTTGTGAATCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027704
ZDHHC11 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027704.2-675s21c1
Sequence:CCGGCGCACGGATCCTCTCTATAAACTCGAGTTTATAGAGAGGATCCGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027704.2-840s21c1
Sequence:CCGGCACTTATACCTGATTACTAAGCTCGAGCTTAGTAATCAGGTATAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027704.2-1106s21c1
Sequence:CCGGGCAAGGATGAGCCCTTCTTTCCTCGAGGAAAGAAGGGCTCATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027704.2-784s21c1
Sequence:CCGGTGGCACTGCTACTAGCTATTGCTCGAGCAATAGCTAGTAGCAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027704.2-322s21c1
Sequence:CCGGTCGTGCACTTGATCGCAATTACTCGAGTAATTGCGATCAAGTGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027704
ZDHHC11 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027704.2-675s21c1
Sequence:CCGGCGCACGGATCCTCTCTATAAACTCGAGTTTATAGAGAGGATCCGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027704.2-840s21c1
Sequence:CCGGCACTTATACCTGATTACTAAGCTCGAGCTTAGTAATCAGGTATAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027704.2-1106s21c1
Sequence:CCGGGCAAGGATGAGCCCTTCTTTCCTCGAGGAAAGAAGGGCTCATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027704.2-784s21c1
Sequence:CCGGTGGCACTGCTACTAGCTATTGCTCGAGCAATAGCTAGTAGCAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027704.2-322s21c1
Sequence:CCGGTCGTGCACTTGATCGCAATTACTCGAGTAATTGCGATCAAGTGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027704
ZDHHC11 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027704.2-675s21c1
Sequence:CCGGCGCACGGATCCTCTCTATAAACTCGAGTTTATAGAGAGGATCCGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027704.2-840s21c1
Sequence:CCGGCACTTATACCTGATTACTAAGCTCGAGCTTAGTAATCAGGTATAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027704.2-1106s21c1
Sequence:CCGGGCAAGGATGAGCCCTTCTTTCCTCGAGGAAAGAAGGGCTCATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027704.2-784s21c1
Sequence:CCGGTGGCACTGCTACTAGCTATTGCTCGAGCAATAGCTAGTAGCAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027704.2-322s21c1
Sequence:CCGGTCGTGCACTTGATCGCAATTACTCGAGTAATTGCGATCAAGTGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks