EMAIL THIS PAGE TO A FRIEND

ZDHHC12

zinc finger, DHHC-type containing 12

Synonyms: ZNF400
Gene ID:
Mouse(66220) zinc finger, DHHC domain containing 12
Rat(366014) zinc finger, DHHC-type containing 12
chicken(417207) zinc finger, DHHC-type containing 12
domestic cat(101081841) zinc finger, DHHC-type containing 12
dog(608478) zinc finger, DHHC-type containing 12
cow(505354) zinc finger, DHHC-type containing 12
sheep(101106672) zinc finger, DHHC-type containing 12
domestic guinea pig(100714303) zinc finger, DHHC-type containing 12
naked mole-rat(101719837) zinc finger, DHHC-type containing 12
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA059339 Anti-ZDHHC12 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025428 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025428 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025428 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032799 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032799 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032799 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032799 Rosetta Predictions human pricing
NM_001013239 Rosetta Predictions rat pricing
NM_001037762 Rosetta Predictions mouse pricing
NM_025428 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032799 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139503 predicted 238
2 SASI_Hs01_00139504 predicted 856
3 SASI_Hs01_00139505 predicted 315
4 SASI_Hs01_00139506 predicted 498
5 SASI_Hs01_00139507 predicted 510
6 SASI_Hs01_00139508 predicted 446
7 SASI_Hs01_00139509 predicted 211
8 SASI_Hs01_00139510 predicted 747
9 SASI_Hs01_00139511 predicted 653
10 SASI_Hs01_00139512 predicted 743
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013239 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089117 predicted 831
2 SASI_Rn01_00089118 predicted 648
3 SASI_Rn01_00089119 predicted 635
4 SASI_Rn01_00089121 predicted 830
5 SASI_Rn01_00089122 predicted 371
6 SASI_Rn01_00089123 predicted 719
7 SASI_Rn01_00089124 predicted 628
8 SASI_Rn01_00089125 predicted 882
9 SASI_Rn01_00089126 predicted 568
10 SASI_Rn02_00201061 predicted 801
11 SASI_Rn01_00089120 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037762 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066297 predicted 480
2 SASI_Mm01_00066298 predicted 919
3 SASI_Mm01_00066299 predicted 678
4 SASI_Mm01_00066300 predicted 671
5 SASI_Mm01_00066301 predicted 655
6 SASI_Mm01_00066302 predicted 664
7 SASI_Mm01_00066303 predicted 911
8 SASI_Mm01_00066304 predicted 918
9 SASI_Mm01_00066305 predicted 395
10 SASI_Mm01_00066306 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025428 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182046 predicted 524
2 SASI_Mm01_00182047 predicted 960
3 SASI_Mm01_00182048 predicted 719
4 SASI_Mm01_00182049 predicted 706
5 SASI_Mm01_00182050 predicted 696
6 SASI_Mm01_00182051 predicted 714
7 SASI_Mm01_00182052 predicted 955
8 SASI_Mm01_00182053 predicted 964
9 SASI_Mm01_00182054 predicted 442
10 SASI_Mm01_00182055 predicted 451
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025428
VALIDATED
ZDHHC12 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 12
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025428.2-441s21c1
Sequence:CCGGCGCTGTGTTCGGCGCTATGATCTCGAGATCATAGCGCCGAACACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025428.2-728s21c1
Sequence:CCGGGTTCATATCTTCACACCGAATCTCGAGATTCGGTGTGAAGATATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025428.2-645s21c1
Sequence:CCGGCTGCTCTCCTTCTTCGCGTTACTCGAGTAACGCGAAGAAGGAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025428.2-974s21c1
Sequence:CCGGCTTTACGTCTTCCTAGGGCTTCTCGAGAAGCCCTAGGAAGACGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025428.2-174s21c1
Sequence:CCGGGCCCACCCGATCACGCAGCTACTCGAGTAGCTGCGTGATCGGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025428.1-716s1c1
Sequence:CCGGGTTCATATCTTCACACCGAATCTCGAGATTCGGTGTGAAGATATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025428.1-961s1c1
Sequence:CCGGCTTTACGTCTTCCTAGGGCTTCTCGAGAAGCCCTAGGAAGACGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025428.1-429s1c1
Sequence:CCGGCGCTGTGTTCGGCGCTATGATCTCGAGATCATAGCGCCGAACACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025428.1-633s1c1
Sequence:CCGGCTGCTCTCCTTCTTCGCGTTACTCGAGTAACGCGAAGAAGGAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025428.1-162s1c1
Sequence:CCGGGCCCACCCGATCACGCAGCTACTCGAGTAGCTGCGTGATCGGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025428
VALIDATED
ZDHHC12 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 12
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025428.2-441s21c1
Sequence:CCGGCGCTGTGTTCGGCGCTATGATCTCGAGATCATAGCGCCGAACACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025428.2-728s21c1
Sequence:CCGGGTTCATATCTTCACACCGAATCTCGAGATTCGGTGTGAAGATATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025428.2-645s21c1
Sequence:CCGGCTGCTCTCCTTCTTCGCGTTACTCGAGTAACGCGAAGAAGGAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025428.2-974s21c1
Sequence:CCGGCTTTACGTCTTCCTAGGGCTTCTCGAGAAGCCCTAGGAAGACGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025428.2-174s21c1
Sequence:CCGGGCCCACCCGATCACGCAGCTACTCGAGTAGCTGCGTGATCGGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025428.1-716s1c1
Sequence:CCGGGTTCATATCTTCACACCGAATCTCGAGATTCGGTGTGAAGATATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025428.1-961s1c1
Sequence:CCGGCTTTACGTCTTCCTAGGGCTTCTCGAGAAGCCCTAGGAAGACGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025428.1-429s1c1
Sequence:CCGGCGCTGTGTTCGGCGCTATGATCTCGAGATCATAGCGCCGAACACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025428.1-633s1c1
Sequence:CCGGCTGCTCTCCTTCTTCGCGTTACTCGAGTAACGCGAAGAAGGAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025428.1-162s1c1
Sequence:CCGGGCCCACCCGATCACGCAGCTACTCGAGTAGCTGCGTGATCGGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025428
VALIDATED
ZDHHC12 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 12
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025428.2-441s21c1
Sequence:CCGGCGCTGTGTTCGGCGCTATGATCTCGAGATCATAGCGCCGAACACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025428.2-728s21c1
Sequence:CCGGGTTCATATCTTCACACCGAATCTCGAGATTCGGTGTGAAGATATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025428.2-645s21c1
Sequence:CCGGCTGCTCTCCTTCTTCGCGTTACTCGAGTAACGCGAAGAAGGAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025428.2-974s21c1
Sequence:CCGGCTTTACGTCTTCCTAGGGCTTCTCGAGAAGCCCTAGGAAGACGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025428.2-174s21c1
Sequence:CCGGGCCCACCCGATCACGCAGCTACTCGAGTAGCTGCGTGATCGGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025428.1-716s1c1
Sequence:CCGGGTTCATATCTTCACACCGAATCTCGAGATTCGGTGTGAAGATATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025428.1-961s1c1
Sequence:CCGGCTTTACGTCTTCCTAGGGCTTCTCGAGAAGCCCTAGGAAGACGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025428.1-429s1c1
Sequence:CCGGCGCTGTGTTCGGCGCTATGATCTCGAGATCATAGCGCCGAACACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025428.1-633s1c1
Sequence:CCGGCTGCTCTCCTTCTTCGCGTTACTCGAGTAACGCGAAGAAGGAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025428.1-162s1c1
Sequence:CCGGGCCCACCCGATCACGCAGCTACTCGAGTAGCTGCGTGATCGGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032799
VALIDATED
ZDHHC12 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 12
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000242745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_032799.4-443s21c1
Sequence:CCGGAGCGCAACCACCCACTCTTTGCTCGAGCAAAGAGTGGGTGGTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_032799.4-676s21c1
Sequence:CCGGTTCATCTCCTCACACCGCATCCTCGAGGATGCGGTGTGAGGAGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_032799.4-857s21c1
Sequence:CCGGGCTACCGTCTTGTGCCTGAAACTCGAGTTTCAGGCACAAGACGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_032799.4-235s21c1
Sequence:CCGGATGGACCCTGGCTACGTGAATCTCGAGATTCACGTAGCCAGGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032799
VALIDATED
ZDHHC12 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 12
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000242745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_032799.4-443s21c1
Sequence:CCGGAGCGCAACCACCCACTCTTTGCTCGAGCAAAGAGTGGGTGGTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_032799.4-676s21c1
Sequence:CCGGTTCATCTCCTCACACCGCATCCTCGAGGATGCGGTGTGAGGAGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_032799.4-857s21c1
Sequence:CCGGGCTACCGTCTTGTGCCTGAAACTCGAGTTTCAGGCACAAGACGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_032799.4-235s21c1
Sequence:CCGGATGGACCCTGGCTACGTGAATCTCGAGATTCACGTAGCCAGGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032799
VALIDATED
ZDHHC12 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 12
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000242745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_032799.4-443s21c1
Sequence:CCGGAGCGCAACCACCCACTCTTTGCTCGAGCAAAGAGTGGGTGGTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_032799.4-676s21c1
Sequence:CCGGTTCATCTCCTCACACCGCATCCTCGAGGATGCGGTGTGAGGAGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_032799.4-857s21c1
Sequence:CCGGGCTACCGTCTTGTGCCTGAAACTCGAGTTTCAGGCACAAGACGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_032799.4-235s21c1
Sequence:CCGGATGGACCCTGGCTACGTGAATCTCGAGATTCACGTAGCCAGGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks