EMAIL THIS PAGE TO A FRIEND

ZDHHC13

zinc finger, DHHC-type containing 13

Synonyms: HIP14L HIP3RP
UniProtKB ID: Q8IUH4, Q7Z2D3, Q86VK2, Q9NV30, Q9NV99
Gene ID:
Mouse(243983) zinc finger, DHHC domain containing 13
Rat(365252) zinc finger, DHHC-type containing 13
Zebrafish(494107) zinc finger, DHHC-type containing 13
Horse(100071954) zinc finger, DHHC-type containing 13
domestic cat(101097344) zinc finger, DHHC-type containing 13
dog(613004) zinc finger, DHHC-type containing 13
chicken(422980) zinc finger, DHHC-type containing 13
naked mole-rat(101720897) zinc finger, DHHC-type containing 13
domestic guinea pig(100724523) zinc finger, DHHC-type containing 13
cow(514176) zinc finger, DHHC-type containing 13
sheep(101116265) zinc finger, DHHC-type containing 13
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019028 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019028 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019028 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028031 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028031 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028031 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001483 Rosetta Predictions human pricing
NM_019028 Rosetta Predictions human pricing
NM_001039037 Rosetta Predictions rat pricing
NM_028031 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150885 predicted 672
2 SASI_Hs01_00150886 predicted 1389
3 SASI_Hs01_00150887 predicted 877
4 SASI_Hs02_00303790 predicted 708
5 SASI_Hs01_00150888 predicted 799
6 SASI_Hs01_00150889 predicted 506
7 SASI_Hs01_00150890 predicted 705
8 SASI_Hs01_00150891 predicted 1766
9 SASI_Hs01_00150892 predicted 1797
10 SASI_Hs01_00150893 predicted 1674
11 SASI_Hs01_00150894 predicted 1267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019028 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033682 predicted 818
2 SASI_Hs01_00033683 predicted 1539
3 SASI_Hs01_00033684 predicted 1021
4 SASI_Hs02_00352584 predicted 862
5 SASI_Hs01_00033685 predicted 948
6 SASI_Hs01_00033686 predicted 654
7 SASI_Hs01_00033687 predicted 851
8 SASI_Hs01_00033688 predicted 1918
9 SASI_Hs01_00033689 predicted 1950
10 SASI_Hs01_00033690 predicted 1827
11 SASI_Hs01_00033691 predicted 1414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039037 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059246 predicted 963
2 SASI_Rn01_00059247 predicted 1385
3 SASI_Rn01_00059248 predicted 1674
4 SASI_Rn01_00059249 predicted 1062
5 SASI_Rn01_00059250 predicted 1512
6 SASI_Rn02_00204791 predicted 243
7 SASI_Rn01_00059251 predicted 1687
8 SASI_Rn01_00059253 predicted 794
9 SASI_Rn01_00059254 predicted 1762
10 SASI_Rn01_00059255 predicted 1077
11 SASI_Rn01_00059252 predicted 1894
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028031 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173166 predicted 987
2 SASI_Mm01_00173167 predicted 1018
3 SASI_Mm01_00173168 predicted 861
4 SASI_Mm01_00173170 predicted 1413
5 SASI_Mm01_00173171 predicted 248
6 SASI_Mm01_00173172 predicted 1572
7 SASI_Mm01_00173173 predicted 1138
8 SASI_Mm01_00173174 predicted 537
9 SASI_Mm01_00173175 predicted 1126
10 SASI_Mm02_00333174 predicted 689
11 SASI_Mm01_00173169 predicted 1554
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019028
VALIDATED
ZDHHC13 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 13
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_019028.1-861s1c1
Sequence:CCGGCTCTTGATATGGCTCTACAAACTCGAGTTTGTAGAGCCATATCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_019028.1-659s1c1
Sequence:CCGGCTCATGTTATCAGCTCACAAACTCGAGTTTGTGAGCTGATAACATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019028.1-371s1c1
Sequence:CCGGGCTATTAACAACAGACTGGATCTCGAGATCCAGTCTGTTGTTAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_019028.1-290s1c1
Sequence:CCGGGAACGATGTAAAGAGTTGGTACTCGAGTACCAACTCTTTACATCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_019028.2-661s21c1
Sequence:CCGGCTCATGTTATCAGCTCACAAACTCGAGTTTGTGAGCTGATAACATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_019028.2-1543s21c1
Sequence:CCGGATGGTATGTGGCTGGATTATACTCGAGTATAATCCAGCCACATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275001    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_019028.2-2242s21c1
Sequence:CCGGTACTCACTGATTATGGATAAACTCGAGTTTATCCATAATCAGTGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_019028.2-487s21c1
Sequence:CCGGCATTTACCTATGGTCATATTACTCGAGTAATATGACCATAGGTAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_019028.2-863s21c1
Sequence:CCGGCTCTTGATATGGCTCTACAAACTCGAGTTTGTAGAGCCATATCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019028
VALIDATED
ZDHHC13 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 13
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_019028.1-861s1c1
Sequence:CCGGCTCTTGATATGGCTCTACAAACTCGAGTTTGTAGAGCCATATCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_019028.1-659s1c1
Sequence:CCGGCTCATGTTATCAGCTCACAAACTCGAGTTTGTGAGCTGATAACATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019028.1-371s1c1
Sequence:CCGGGCTATTAACAACAGACTGGATCTCGAGATCCAGTCTGTTGTTAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_019028.1-290s1c1
Sequence:CCGGGAACGATGTAAAGAGTTGGTACTCGAGTACCAACTCTTTACATCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_019028.2-661s21c1
Sequence:CCGGCTCATGTTATCAGCTCACAAACTCGAGTTTGTGAGCTGATAACATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_019028.2-1543s21c1
Sequence:CCGGATGGTATGTGGCTGGATTATACTCGAGTATAATCCAGCCACATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275001    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_019028.2-2242s21c1
Sequence:CCGGTACTCACTGATTATGGATAAACTCGAGTTTATCCATAATCAGTGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_019028.2-487s21c1
Sequence:CCGGCATTTACCTATGGTCATATTACTCGAGTAATATGACCATAGGTAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_019028.2-863s21c1
Sequence:CCGGCTCTTGATATGGCTCTACAAACTCGAGTTTGTAGAGCCATATCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019028
VALIDATED
ZDHHC13 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 13
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_019028.1-861s1c1
Sequence:CCGGCTCTTGATATGGCTCTACAAACTCGAGTTTGTAGAGCCATATCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_019028.1-659s1c1
Sequence:CCGGCTCATGTTATCAGCTCACAAACTCGAGTTTGTGAGCTGATAACATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019028.1-371s1c1
Sequence:CCGGGCTATTAACAACAGACTGGATCTCGAGATCCAGTCTGTTGTTAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_019028.1-290s1c1
Sequence:CCGGGAACGATGTAAAGAGTTGGTACTCGAGTACCAACTCTTTACATCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_019028.2-661s21c1
Sequence:CCGGCTCATGTTATCAGCTCACAAACTCGAGTTTGTGAGCTGATAACATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_019028.2-1543s21c1
Sequence:CCGGATGGTATGTGGCTGGATTATACTCGAGTATAATCCAGCCACATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275001    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_019028.2-2242s21c1
Sequence:CCGGTACTCACTGATTATGGATAAACTCGAGTTTATCCATAATCAGTGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_019028.2-487s21c1
Sequence:CCGGCATTTACCTATGGTCATATTACTCGAGTAATATGACCATAGGTAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_019028.2-863s21c1
Sequence:CCGGCTCTTGATATGGCTCTACAAACTCGAGTTTGTAGAGCCATATCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028031
VALIDATED
ZDHHC13 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 13
Mouse
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028031.1-376s1c1
Sequence:CCGGGCCATTAACAACAGGCTGGAACTCGAGTTCCAGCCTGTTGTTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028031.1-865s1c1
Sequence:CCGGCCTCTTGATATGGCTCTACAACTCGAGTTGTAGAGCCATATCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028031.1-938s1c1
Sequence:CCGGCCAACAAACAGTTTCGGCTTTCTCGAGAAAGCCGAAACTGTTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028031.1-1901s1c1
Sequence:CCGGCCTGCATCATAGATTGGACATCTCGAGATGTCCAATCTATGATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028031.1-2187s1c1
Sequence:CCGGCCCAAGAACATGAGTTACTTTCTCGAGAAAGTAACTCATGTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028031.3-1729s21c1
Sequence:CCGGCAACTCTTTCAGATTGCATTTCTCGAGAAATGCAATCTGAAAGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028031.3-1028s21c1
Sequence:CCGGGATACATCCTGGACTTCAATTCTCGAGAATTGAAGTCCAGGATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028031.3-493s21c1
Sequence:CCGGTTGCCTATGGTCATATTATTGCTCGAGCAATAATATGACCATAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028031.3-437s21c1
Sequence:CCGGAGTTGGGTGGTGACCTAAATTCTCGAGAATTTAGGTCACCACCCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028031.3-1578s21c1
Sequence:CCGGCGTCTACTGGTCAAATCATTGCTCGAGCAATGATTTGACCAGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028031.3-266s21c1
Sequence:CCGGTTGTCAAAGCTACACAATATGCTCGAGCATATTGTGTAGCTTTGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028031.3-1696s21c1
Sequence:CCGGCACTTCTCATGGTCAACATTTCTCGAGAAATGTTGACCATGAGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028031.3-2216s21c1
Sequence:CCGGACCTAATAGTCACTGATTATGCTCGAGCATAATCAGTGACTATTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028031.3-1547s21c1
Sequence:CCGGTGGTATGTGACTGGATCATATCTCGAGATATGATCCAGTCACATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028031.3-632s21c1
Sequence:CCGGTGAATATGACAGATGTCAATGCTCGAGCATTGACATCTGTCATATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028031.3-2056s21c1
Sequence:CCGGATTCAGCTACCACGGTCAAAGCTCGAGCTTTGACCGTGGTAGCTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028031
VALIDATED
ZDHHC13 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 13
Mouse
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028031.1-376s1c1
Sequence:CCGGGCCATTAACAACAGGCTGGAACTCGAGTTCCAGCCTGTTGTTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028031.1-865s1c1
Sequence:CCGGCCTCTTGATATGGCTCTACAACTCGAGTTGTAGAGCCATATCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028031.1-938s1c1
Sequence:CCGGCCAACAAACAGTTTCGGCTTTCTCGAGAAAGCCGAAACTGTTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028031.1-1901s1c1
Sequence:CCGGCCTGCATCATAGATTGGACATCTCGAGATGTCCAATCTATGATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028031.1-2187s1c1
Sequence:CCGGCCCAAGAACATGAGTTACTTTCTCGAGAAAGTAACTCATGTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028031.3-1729s21c1
Sequence:CCGGCAACTCTTTCAGATTGCATTTCTCGAGAAATGCAATCTGAAAGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028031.3-1028s21c1
Sequence:CCGGGATACATCCTGGACTTCAATTCTCGAGAATTGAAGTCCAGGATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028031.3-493s21c1
Sequence:CCGGTTGCCTATGGTCATATTATTGCTCGAGCAATAATATGACCATAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028031.3-437s21c1
Sequence:CCGGAGTTGGGTGGTGACCTAAATTCTCGAGAATTTAGGTCACCACCCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028031.3-1578s21c1
Sequence:CCGGCGTCTACTGGTCAAATCATTGCTCGAGCAATGATTTGACCAGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028031.3-266s21c1
Sequence:CCGGTTGTCAAAGCTACACAATATGCTCGAGCATATTGTGTAGCTTTGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028031.3-1696s21c1
Sequence:CCGGCACTTCTCATGGTCAACATTTCTCGAGAAATGTTGACCATGAGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028031.3-2216s21c1
Sequence:CCGGACCTAATAGTCACTGATTATGCTCGAGCATAATCAGTGACTATTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028031.3-1547s21c1
Sequence:CCGGTGGTATGTGACTGGATCATATCTCGAGATATGATCCAGTCACATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028031.3-632s21c1
Sequence:CCGGTGAATATGACAGATGTCAATGCTCGAGCATTGACATCTGTCATATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028031.3-2056s21c1
Sequence:CCGGATTCAGCTACCACGGTCAAAGCTCGAGCTTTGACCGTGGTAGCTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028031
VALIDATED
ZDHHC13 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 13
Mouse
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028031.1-376s1c1
Sequence:CCGGGCCATTAACAACAGGCTGGAACTCGAGTTCCAGCCTGTTGTTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028031.1-865s1c1
Sequence:CCGGCCTCTTGATATGGCTCTACAACTCGAGTTGTAGAGCCATATCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028031.1-938s1c1
Sequence:CCGGCCAACAAACAGTTTCGGCTTTCTCGAGAAAGCCGAAACTGTTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028031.1-1901s1c1
Sequence:CCGGCCTGCATCATAGATTGGACATCTCGAGATGTCCAATCTATGATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028031.1-2187s1c1
Sequence:CCGGCCCAAGAACATGAGTTACTTTCTCGAGAAAGTAACTCATGTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028031.3-1729s21c1
Sequence:CCGGCAACTCTTTCAGATTGCATTTCTCGAGAAATGCAATCTGAAAGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028031.3-1028s21c1
Sequence:CCGGGATACATCCTGGACTTCAATTCTCGAGAATTGAAGTCCAGGATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028031.3-493s21c1
Sequence:CCGGTTGCCTATGGTCATATTATTGCTCGAGCAATAATATGACCATAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028031.3-437s21c1
Sequence:CCGGAGTTGGGTGGTGACCTAAATTCTCGAGAATTTAGGTCACCACCCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028031.3-1578s21c1
Sequence:CCGGCGTCTACTGGTCAAATCATTGCTCGAGCAATGATTTGACCAGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028031.3-266s21c1
Sequence:CCGGTTGTCAAAGCTACACAATATGCTCGAGCATATTGTGTAGCTTTGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028031.3-1696s21c1
Sequence:CCGGCACTTCTCATGGTCAACATTTCTCGAGAAATGTTGACCATGAGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028031.3-2216s21c1
Sequence:CCGGACCTAATAGTCACTGATTATGCTCGAGCATAATCAGTGACTATTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028031.3-1547s21c1
Sequence:CCGGTGGTATGTGACTGGATCATATCTCGAGATATGATCCAGTCACATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028031.3-632s21c1
Sequence:CCGGTGAATATGACAGATGTCAATGCTCGAGCATTGACATCTGTCATATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028031.3-2056s21c1
Sequence:CCGGATTCAGCTACCACGGTCAAAGCTCGAGCTTTGACCGTGGTAGCTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks