EMAIL THIS PAGE TO A FRIEND

ZDHHC14

zinc finger, DHHC-type containing 14

Synonyms: NEW1CP
Gene ID:
Mouse(224454) zinc finger, DHHC domain containing 14
Rat(499014) zinc finger, DHHC-type containing 14
cow(517451) zinc finger, DHHC-type containing 14
sheep(101107710) zinc finger, DHHC-type containing 14
domestic guinea pig(100715880) zinc finger, DHHC-type containing 14
naked mole-rat(101702460) zinc finger, DHHC-type containing 14
Domestic Rabbit(100337908) zinc finger, DHHC-type containing 14
Zebrafish(569667) zinc finger, DHHC-type containing 14
domestic cat(101086812) zinc finger, DHHC-type containing 14
Horse(100051142) zinc finger, DHHC-type containing 14
dog(612148) zinc finger, DHHC-type containing 14
chicken(421653) zinc finger, DHHC-type containing 14
98 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024630 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024630 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024630 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146073 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146073 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146073 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024630 Rosetta Predictions human pricing
NM_153746 Rosetta Predictions human pricing
NM_001039343 Rosetta Predictions rat pricing
NM_146073 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024630 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126654 predicted 1067
2 SASI_Hs01_00126655 predicted 785
3 SASI_Hs01_00126656 predicted 1305
4 SASI_Hs01_00126657 predicted 1183
5 SASI_Hs01_00126658 predicted 1027
6 SASI_Hs01_00126659 predicted 1153
7 SASI_Hs01_00126660 predicted 1209
8 SASI_Hs01_00126661 predicted 2133
9 SASI_Hs01_00126662 predicted 890
10 SASI_Hs01_00126663 predicted 879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153746 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201501 predicted 1068
2 SASI_Hs01_00201502 predicted 791
3 SASI_Hs01_00201503 predicted 1311
4 SASI_Hs01_00201504 predicted 1185
5 SASI_Hs01_00201505 predicted 1026
6 SASI_Hs01_00201506 predicted 1157
7 SASI_Hs01_00201507 predicted 1203
8 SASI_Hs01_00201508 predicted 2088
9 SASI_Hs01_00201509 predicted 891
10 SASI_Hs01_00201510 predicted 885
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039343 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119352 predicted 1716
2 SASI_Rn01_00119353 predicted 1787
3 SASI_Rn01_00119354 predicted 1423
4 SASI_Rn01_00119356 predicted 1693
5 SASI_Rn01_00119357 predicted 1858
6 SASI_Rn02_00204827 predicted 1891
7 SASI_Rn01_00119358 predicted 1962
8 SASI_Rn02_00204828 predicted 1840
9 SASI_Rn01_00119359 predicted 1640
10 SASI_Rn01_00119360 predicted 1624
11 SASI_Rn01_00119355 predicted 1901
12 SASI_Rn01_00119361 predicted 1280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146073 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115895 predicted 1758
2 SASI_Mm01_00115896 predicted 1230
3 SASI_Mm01_00115897 predicted 1538
4 SASI_Mm01_00115899 predicted 1928
5 SASI_Mm02_00341702 predicted 2216
6 SASI_Mm01_00115900 predicted 1866
7 SASI_Mm01_00115901 predicted 1298
8 SASI_Mm01_00115902 predicted 1805
9 SASI_Mm01_00115903 predicted 1302
10 SASI_Mm01_00115904 predicted 1492
11 SASI_Mm01_00115898 predicted 1046
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024630
VALIDATED
ZDHHC14 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 14
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024630.2-906s21c1
Sequence:CCGGATCGCAAACGGCACCAGTTCACTCGAGTGAACTGGTGCCGTTTGCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024630.2-1304s21c1
Sequence:CCGGAGGATTCCACACCTACTTGATCTCGAGATCAAGTAGGTGTGGAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024630.2-1176s21c1
Sequence:CCGGTTCGTTATCACCCACGTCATTCTCGAGAATGACGTGGGTGATAACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024630.2-1405s1c1
Sequence:CCGGGCTACGGAAATATCTTTACCACTCGAGTGGTAAAGATATTTCCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024630.2-1580s1c1
Sequence:CCGGGTGCATTCAGAGCACCAAATTCTCGAGAATTTGGTGCTCTGAATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149757    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024630.2-2136s1c1
Sequence:CCGGGCTGAGAGCTTGGTTTCATTTCTCGAGAAATGAAACCAAGCTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024630.2-1213s1c1
Sequence:CCGGCAGGATTCCTAAATGCCCTTACTCGAGTAAGGGCATTTAGGAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024630.2-2173s1c1
Sequence:CCGGCCTGAGTGCTTTGACAACAATCTCGAGATTGTTGTCAAAGCACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024630.2-1334s1c1
Sequence:CCGGCCAGACAACAAATGAGGACATCTCGAGATGTCCTCATTTGTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024630
VALIDATED
ZDHHC14 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 14
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024630.2-906s21c1
Sequence:CCGGATCGCAAACGGCACCAGTTCACTCGAGTGAACTGGTGCCGTTTGCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024630.2-1304s21c1
Sequence:CCGGAGGATTCCACACCTACTTGATCTCGAGATCAAGTAGGTGTGGAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024630.2-1176s21c1
Sequence:CCGGTTCGTTATCACCCACGTCATTCTCGAGAATGACGTGGGTGATAACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024630.2-1405s1c1
Sequence:CCGGGCTACGGAAATATCTTTACCACTCGAGTGGTAAAGATATTTCCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024630.2-1580s1c1
Sequence:CCGGGTGCATTCAGAGCACCAAATTCTCGAGAATTTGGTGCTCTGAATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149757    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024630.2-2136s1c1
Sequence:CCGGGCTGAGAGCTTGGTTTCATTTCTCGAGAAATGAAACCAAGCTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024630.2-1213s1c1
Sequence:CCGGCAGGATTCCTAAATGCCCTTACTCGAGTAAGGGCATTTAGGAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024630.2-2173s1c1
Sequence:CCGGCCTGAGTGCTTTGACAACAATCTCGAGATTGTTGTCAAAGCACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024630.2-1334s1c1
Sequence:CCGGCCAGACAACAAATGAGGACATCTCGAGATGTCCTCATTTGTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024630
VALIDATED
ZDHHC14 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 14
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024630.2-906s21c1
Sequence:CCGGATCGCAAACGGCACCAGTTCACTCGAGTGAACTGGTGCCGTTTGCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024630.2-1304s21c1
Sequence:CCGGAGGATTCCACACCTACTTGATCTCGAGATCAAGTAGGTGTGGAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024630.2-1176s21c1
Sequence:CCGGTTCGTTATCACCCACGTCATTCTCGAGAATGACGTGGGTGATAACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024630.2-1405s1c1
Sequence:CCGGGCTACGGAAATATCTTTACCACTCGAGTGGTAAAGATATTTCCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024630.2-1580s1c1
Sequence:CCGGGTGCATTCAGAGCACCAAATTCTCGAGAATTTGGTGCTCTGAATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149757    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024630.2-2136s1c1
Sequence:CCGGGCTGAGAGCTTGGTTTCATTTCTCGAGAAATGAAACCAAGCTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024630.2-1213s1c1
Sequence:CCGGCAGGATTCCTAAATGCCCTTACTCGAGTAAGGGCATTTAGGAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024630.2-2173s1c1
Sequence:CCGGCCTGAGTGCTTTGACAACAATCTCGAGATTGTTGTCAAAGCACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024630.2-1334s1c1
Sequence:CCGGCCAGACAACAAATGAGGACATCTCGAGATGTCCTCATTTGTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146073
VALIDATED
ZDHHC14 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146073.3-1495s1c1
Sequence:CCGGCCTGTCCTTTCTGACAGTCTTCTCGAGAAGACTGTCAGAAAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146073.3-1928s1c1
Sequence:CCGGCAGTGCATTCAGAGCACCAAACTCGAGTTTGGTGCTCTGAATGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146073.3-1329s1c1
Sequence:CCGGCCGTGAAACTAAAGTACTGTTCTCGAGAACAGTACTTTAGTTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146073.3-2589s1c1
Sequence:CCGGCCGTTCCATTTGTTCATTAAACTCGAGTTTAATGAACAAATGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146073.3-976s1c1
Sequence:CCGGCCCAGGAAGAAACAAGTTCTTCTCGAGAAGAACTTGTTTCTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146073
VALIDATED
ZDHHC14 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146073.3-1495s1c1
Sequence:CCGGCCTGTCCTTTCTGACAGTCTTCTCGAGAAGACTGTCAGAAAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146073.3-1928s1c1
Sequence:CCGGCAGTGCATTCAGAGCACCAAACTCGAGTTTGGTGCTCTGAATGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146073.3-1329s1c1
Sequence:CCGGCCGTGAAACTAAAGTACTGTTCTCGAGAACAGTACTTTAGTTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146073.3-2589s1c1
Sequence:CCGGCCGTTCCATTTGTTCATTAAACTCGAGTTTAATGAACAAATGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146073.3-976s1c1
Sequence:CCGGCCCAGGAAGAAACAAGTTCTTCTCGAGAAGAACTTGTTTCTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146073
VALIDATED
ZDHHC14 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146073.3-1495s1c1
Sequence:CCGGCCTGTCCTTTCTGACAGTCTTCTCGAGAAGACTGTCAGAAAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146073.3-1928s1c1
Sequence:CCGGCAGTGCATTCAGAGCACCAAACTCGAGTTTGGTGCTCTGAATGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146073.3-1329s1c1
Sequence:CCGGCCGTGAAACTAAAGTACTGTTCTCGAGAACAGTACTTTAGTTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146073.3-2589s1c1
Sequence:CCGGCCGTTCCATTTGTTCATTAAACTCGAGTTTAATGAACAAATGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146073.3-976s1c1
Sequence:CCGGCCCAGGAAGAAACAAGTTCTTCTCGAGAAGAACTTGTTTCTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks