EMAIL THIS PAGE TO A FRIEND

ZDHHC15

zinc finger, DHHC-type containing 15

Synonyms: MRX91
UniProtKB ID: Q96MV8, B3KVG7, Q3SY30, Q6UWH3
Gene ID:
Human(158866) Summary: The protein encoded by this gene belongs to the DHHC palmitoyltransferase family. Mutations in this gene are associated with mental retardatio X-linked type 91 (MRX91). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(108672) zinc finger, DHHC domain containing 15
Rat(317235) zinc finger, DHHC-type containing 15
chicken(422329) zinc finger, DHHC-type containing 15
Horse(100059217) zinc finger, DHHC-type containing 15
dog(608203) zinc finger, DHHC-type containing 15
domestic cat(101083492) zinc finger, DHHC-type containing 15
naked mole-rat(101720541) zinc finger, DHHC-type containing 15
domestic guinea pig(100717748) zinc finger, DHHC-type containing 15
cow(615421) zinc finger, DHHC-type containing 15
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144969 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144969 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144969 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175358 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175358 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175358 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144969 Rosetta Predictions human pricing
NM_001039101 Rosetta Predictions rat pricing
NM_175358 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206034 predicted 478
2 SASI_Hs01_00206035 predicted 453
3 SASI_Hs01_00206036 predicted 693
4 SASI_Hs01_00206037 predicted 290
5 SASI_Hs01_00206038 predicted 794
6 SASI_Hs02_00364759 predicted 655
7 SASI_Hs01_00206041 predicted 361
8 SASI_Hs02_00364760 predicted 632
9 SASI_Hs01_00206043 predicted 394
10 SASI_Hs02_00364761 predicted 556
11 SASI_Hs01_00206039 predicted 996
12 SASI_Hs01_00206040 predicted 899
13 SASI_Hs01_00206042 predicted 978
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039101 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056308 predicted 367
2 SASI_Rn01_00056310 predicted 729
3 SASI_Rn02_00204799 predicted 739
4 SASI_Rn01_00056311 predicted 848
5 SASI_Rn01_00056312 predicted 1258
6 SASI_Rn01_00056313 predicted 825
7 SASI_Rn01_00056314 predicted 679
8 SASI_Rn01_00056315 predicted 848
9 SASI_Rn01_00056317 predicted 304
10 SASI_Rn02_00204800 predicted 586
11 SASI_Rn01_00056309 predicted 1077
12 SASI_Rn01_00056316 predicted 1023
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175358 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188628 predicted 1118
2 SASI_Mm01_00188630 predicted 335
3 SASI_Mm02_00346157 predicted 1083
4 SASI_Mm01_00188631 predicted 1063
5 SASI_Mm01_00188632 predicted 948
6 SASI_Mm01_00188633 predicted 528
7 SASI_Mm01_00188634 predicted 277
8 SASI_Mm01_00188635 predicted 482
9 SASI_Mm01_00188636 predicted 463
10 SASI_Mm01_00188637 predicted 619
11 SASI_Mm01_00188629 predicted 956
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144969
ZDHHC15 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 15
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144969.1-494s1c1
Sequence:CCGGCCTTGGGTTAATAACTGCATTCTCGAGAATGCAGTTATTAACCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144969.1-826s1c1
Sequence:CCGGCCAGCAGGTGTTTGGAGATAACTCGAGTTATCTCCAAACACCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144969.1-582s1c1
Sequence:CCGGCTACGACAGTCTTCAGCTATTCTCGAGAATAGCTGAAGACTGTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144969.1-941s1c1
Sequence:CCGGGCAAATGAAGAAACCTGGGAACTCGAGTTCCCAGGTTTCTTCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144969.1-698s1c1
Sequence:CCGGGTGATTCTCTTTGGTTACCATCTCGAGATGGTAACCAAAGAGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145091    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144969.1-1486s1c1
Sequence:CCGGGAACACGTACAGCATATCTATCTCGAGATAGATATGCTGTACGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144969.1-1175s1c1
Sequence:CCGGCCATCAAATACTTGCTGTGTACTCGAGTACACAGCAAGTATTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144969.2-570s21c1
Sequence:CCGGTCGTGCTCTGGTCCTACTATGCTCGAGCATAGTAGGACCAGAGCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144969.2-1800s21c1
Sequence:CCGGTCATTCATCTTATCAGGTAAACTCGAGTTTACCTGATAAGATGAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144969.2-1046s21c1
Sequence:CCGGACGACAGTCTTCAGCTATTTCCTCGAGGAAATAGCTGAAGACTGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144969
ZDHHC15 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 15
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144969.1-494s1c1
Sequence:CCGGCCTTGGGTTAATAACTGCATTCTCGAGAATGCAGTTATTAACCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144969.1-826s1c1
Sequence:CCGGCCAGCAGGTGTTTGGAGATAACTCGAGTTATCTCCAAACACCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144969.1-582s1c1
Sequence:CCGGCTACGACAGTCTTCAGCTATTCTCGAGAATAGCTGAAGACTGTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144969.1-941s1c1
Sequence:CCGGGCAAATGAAGAAACCTGGGAACTCGAGTTCCCAGGTTTCTTCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144969.1-698s1c1
Sequence:CCGGGTGATTCTCTTTGGTTACCATCTCGAGATGGTAACCAAAGAGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145091    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144969.1-1486s1c1
Sequence:CCGGGAACACGTACAGCATATCTATCTCGAGATAGATATGCTGTACGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144969.1-1175s1c1
Sequence:CCGGCCATCAAATACTTGCTGTGTACTCGAGTACACAGCAAGTATTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144969.2-570s21c1
Sequence:CCGGTCGTGCTCTGGTCCTACTATGCTCGAGCATAGTAGGACCAGAGCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144969.2-1800s21c1
Sequence:CCGGTCATTCATCTTATCAGGTAAACTCGAGTTTACCTGATAAGATGAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144969.2-1046s21c1
Sequence:CCGGACGACAGTCTTCAGCTATTTCCTCGAGGAAATAGCTGAAGACTGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144969
ZDHHC15 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 15
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144969.1-494s1c1
Sequence:CCGGCCTTGGGTTAATAACTGCATTCTCGAGAATGCAGTTATTAACCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144969.1-826s1c1
Sequence:CCGGCCAGCAGGTGTTTGGAGATAACTCGAGTTATCTCCAAACACCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144969.1-582s1c1
Sequence:CCGGCTACGACAGTCTTCAGCTATTCTCGAGAATAGCTGAAGACTGTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144969.1-941s1c1
Sequence:CCGGGCAAATGAAGAAACCTGGGAACTCGAGTTCCCAGGTTTCTTCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144969.1-698s1c1
Sequence:CCGGGTGATTCTCTTTGGTTACCATCTCGAGATGGTAACCAAAGAGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145091    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144969.1-1486s1c1
Sequence:CCGGGAACACGTACAGCATATCTATCTCGAGATAGATATGCTGTACGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144969.1-1175s1c1
Sequence:CCGGCCATCAAATACTTGCTGTGTACTCGAGTACACAGCAAGTATTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144969.2-570s21c1
Sequence:CCGGTCGTGCTCTGGTCCTACTATGCTCGAGCATAGTAGGACCAGAGCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144969.2-1800s21c1
Sequence:CCGGTCATTCATCTTATCAGGTAAACTCGAGTTTACCTGATAAGATGAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144969.2-1046s21c1
Sequence:CCGGACGACAGTCTTCAGCTATTTCCTCGAGGAAATAGCTGAAGACTGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175358
ZDHHC15 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 15
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175358.2-266s1c1
Sequence:CCGGCCACTTGTCCTATACAGACAACTCGAGTTGTCTGTATAGGACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175358.2-536s1c1
Sequence:CCGGCTTAGCTTATTCCGTTCTCTACTCGAGTAGAGAACGGAATAAGCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175358.2-176s1c1
Sequence:CCGGCCTCATACTCTATCATGCCATCTCGAGATGGCATGATAGAGTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175358.2-830s1c1
Sequence:CCGGCGATAATAAGAAGTTCTGGTTCTCGAGAACCAGAACTTCTTATTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175358.2-1579s1c1
Sequence:CCGGCCCTGTATCAAGTATCTGAAACTCGAGTTTCAGATACTTGATACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175358.4-329s21c1
Sequence:CCGGTGGGTGCCAGTGCTCGTTATTCTCGAGAATAACGAGCACTGGCACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175358.4-1593s21c1
Sequence:CCGGGATTGCCTTAGAGTCTAATTCCTCGAGGAATTAGACTCTAAGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175358.4-1720s21c1
Sequence:CCGGATGTGCAATATATCGATATAGCTCGAGCTATATCGATATATTGCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175358
ZDHHC15 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 15
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175358.2-266s1c1
Sequence:CCGGCCACTTGTCCTATACAGACAACTCGAGTTGTCTGTATAGGACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175358.2-536s1c1
Sequence:CCGGCTTAGCTTATTCCGTTCTCTACTCGAGTAGAGAACGGAATAAGCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175358.2-176s1c1
Sequence:CCGGCCTCATACTCTATCATGCCATCTCGAGATGGCATGATAGAGTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175358.2-830s1c1
Sequence:CCGGCGATAATAAGAAGTTCTGGTTCTCGAGAACCAGAACTTCTTATTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175358.2-1579s1c1
Sequence:CCGGCCCTGTATCAAGTATCTGAAACTCGAGTTTCAGATACTTGATACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175358.4-329s21c1
Sequence:CCGGTGGGTGCCAGTGCTCGTTATTCTCGAGAATAACGAGCACTGGCACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175358.4-1593s21c1
Sequence:CCGGGATTGCCTTAGAGTCTAATTCCTCGAGGAATTAGACTCTAAGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175358.4-1720s21c1
Sequence:CCGGATGTGCAATATATCGATATAGCTCGAGCTATATCGATATATTGCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175358
ZDHHC15 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 15
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175358.2-266s1c1
Sequence:CCGGCCACTTGTCCTATACAGACAACTCGAGTTGTCTGTATAGGACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175358.2-536s1c1
Sequence:CCGGCTTAGCTTATTCCGTTCTCTACTCGAGTAGAGAACGGAATAAGCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175358.2-176s1c1
Sequence:CCGGCCTCATACTCTATCATGCCATCTCGAGATGGCATGATAGAGTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175358.2-830s1c1
Sequence:CCGGCGATAATAAGAAGTTCTGGTTCTCGAGAACCAGAACTTCTTATTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175358.2-1579s1c1
Sequence:CCGGCCCTGTATCAAGTATCTGAAACTCGAGTTTCAGATACTTGATACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175358.4-329s21c1
Sequence:CCGGTGGGTGCCAGTGCTCGTTATTCTCGAGAATAACGAGCACTGGCACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175358.4-1593s21c1
Sequence:CCGGGATTGCCTTAGAGTCTAATTCCTCGAGGAATTAGACTCTAAGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175358.4-1720s21c1
Sequence:CCGGATGTGCAATATATCGATATAGCTCGAGCTATATCGATATATTGCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks