EMAIL THIS PAGE TO A FRIEND

ZDHHC16

zinc finger, DHHC-type containing 16

Synonyms: APH2
Gene ID:
Mouse(74168) zinc finger, DHHC domain containing 16
Rat(654495) zinc finger, DHHC-type containing 16
chicken(423843) zinc finger, DHHC-type containing 16
dog(486820) zinc finger, DHHC-type containing 16
domestic cat(101099590) zinc finger, DHHC-type containing 16
Horse(100061023) zinc finger, DHHC-type containing 16
cow(506085) zinc finger, DHHC-type containing 16
sheep(101114070) zinc finger, DHHC-type containing 16
Goat(100861064) zinc finger, DHHC-type containing 16
domestic guinea pig(100719566) zinc finger, DHHC-type containing 16
naked mole-rat(101696320) zinc finger, DHHC-type containing 16
Domestic Rabbit(100344180) zinc finger, DHHC-type containing 16
142 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032327 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032327 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032327 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023740 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023740 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023740 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032327 Rosetta Predictions human pricing
NM_198043 Rosetta Predictions human pricing
NM_198044 Rosetta Predictions human pricing
NM_198045 Rosetta Predictions human pricing
NM_198046 Rosetta Predictions human pricing
NM_001039346 Rosetta Predictions rat pricing
NM_023740 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032327 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359698 predicted 1171
2 SASI_Hs01_00050560 predicted 1345
3 SASI_Hs01_00050561 predicted 1178
4 SASI_Hs01_00050562 predicted 1130
5 SASI_Hs01_00050563 predicted 1343
6 SASI_Hs01_00050565 predicted 1439
7 SASI_Hs01_00050566 predicted 1126
8 SASI_Hs01_00050567 predicted 1505
9 SASI_Hs01_00050568 predicted 1491
10 SASI_Hs01_00050569 predicted 1562
11 SASI_Hs01_00050564 predicted 1397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198043 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022472 predicted 1128
2 SASI_Hs01_00022473 predicted 1301
3 SASI_Hs01_00022474 predicted 1124
4 SASI_Hs01_00022475 predicted 1075
5 SASI_Hs01_00022476 predicted 1298
6 SASI_Hs01_00022478 predicted 1386
7 SASI_Hs01_00022479 predicted 1080
8 SASI_Hs01_00022480 predicted 1461
9 SASI_Hs01_00022481 predicted 1445
10 SASI_Hs02_00371603 predicted 1518
11 SASI_Hs01_00022477 predicted 1352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198044 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078332 predicted 1057
2 SASI_Hs01_00078333 predicted 1225
3 SASI_Hs01_00078334 predicted 1055
4 SASI_Hs01_00078335 predicted 1008
5 SASI_Hs01_00078336 predicted 1222
6 SASI_Hs01_00078338 predicted 1322
7 SASI_Hs01_00078339 predicted 1006
8 SASI_Hs01_00078340 predicted 1387
9 SASI_Hs01_00078341 predicted 1375
10 SASI_Hs02_00371604 predicted 1449
11 SASI_Hs01_00078337 predicted 1285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371605 predicted 929
2 SASI_Hs01_00223105 predicted 1104
3 SASI_Hs01_00223106 predicted 928
4 SASI_Hs01_00223107 predicted 880
5 SASI_Hs01_00223108 predicted 1101
6 SASI_Hs01_00223110 predicted 1193
7 SASI_Hs01_00223111 predicted 884
8 SASI_Hs01_00223112 predicted 1270
9 SASI_Hs01_00223113 predicted 1247
10 SASI_Hs01_00223114 predicted 1321
11 SASI_Hs01_00223109 predicted 1159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198046 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371606 predicted 1335
2 SASI_Hs01_00099551 predicted 1504
3 SASI_Hs01_00099552 predicted 1334
4 SASI_Hs01_00099553 predicted 1289
5 SASI_Hs01_00099554 predicted 1502
6 SASI_Hs01_00099556 predicted 1594
7 SASI_Hs01_00099557 predicted 1290
8 SASI_Hs01_00099558 predicted 1667
9 SASI_Hs01_00099559 predicted 1661
10 SASI_Hs01_00099560 predicted 1728
11 SASI_Hs01_00099555 predicted 1559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039346 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100411 predicted 1022
2 SASI_Rn01_00100412 predicted 588
3 SASI_Rn01_00100413 predicted 1003
4 SASI_Rn01_00100414 predicted 1403
5 SASI_Rn01_00100415 predicted 1393
6 SASI_Rn01_00100416 predicted 512
7 SASI_Rn01_00100417 predicted 1136
8 SASI_Rn01_00100418 predicted 873
9 SASI_Rn01_00100419 predicted 753
10 SASI_Rn01_00100420 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023740 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132019 predicted 1050
2 SASI_Mm01_00132021 predicted 543
3 SASI_Mm01_00132022 predicted 1077
4 SASI_Mm01_00132023 predicted 568
5 SASI_Mm01_00132024 predicted 781
6 SASI_Mm01_00132025 predicted 1421
7 SASI_Mm01_00132026 predicted 985
8 SASI_Mm01_00132027 predicted 1242
9 SASI_Mm01_00132028 predicted 799
10 SASI_Mm02_00327320 predicted 975
11 SASI_Mm01_00132020 predicted 664
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032327
VALIDATED
ZDHHC16 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 16
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032327.2-910s21c1
Sequence:CCGGGCGGTTGCCAACCAGACTTATCTCGAGATAAGTCTGGTTGGCAACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032327.2-554s21c1
Sequence:CCGGACTGGAATCTGATCCTGATTGCTCGAGCAATCAGGATCAGATTCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032327.2-775s21c1
Sequence:CCGCCATCGGTACTTCTTCTCTTTCCTCGAGGAAAGAGAAGAAGTACCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032327.2-1068s21c1
Sequence:CCGGAGGTGAGACTAGCATCGAAAGCTCGAGCTTTCGATGCTAGTCTCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032327.2-753s21c1
Sequence:CCGGCAATTGTGTGGGCCACTATAACTCGAGTTATAGTGGCCCACACAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032327.2-650s1c1
Sequence:CCGGCCATCTGTAAGAAGTGCATTTCTCGAGAAATGCACTTCTTACAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032327.2-1130s1c1
Sequence:CCGGGCAGAGTATTTAGGAATCCTTCTCGAGAAGGATTCCTAAATACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032327.2-1503s1c1
Sequence:CCGGGAGAAATCTTAGGACTGACATCTCGAGATGTCAGTCCTAAGATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148036    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032327.2-1488s1c1
Sequence:CCGGGAAAGACACAATGTGGAGAAACTCGAGTTTCTCCACATTGTGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032327.2-830s1c1
Sequence:CCGGGCTATGGAAGTTGGGACCTTTCTCGAGAAAGGTCCCAACTTCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032327
VALIDATED
ZDHHC16 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 16
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032327.2-910s21c1
Sequence:CCGGGCGGTTGCCAACCAGACTTATCTCGAGATAAGTCTGGTTGGCAACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032327.2-554s21c1
Sequence:CCGGACTGGAATCTGATCCTGATTGCTCGAGCAATCAGGATCAGATTCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032327.2-775s21c1
Sequence:CCGCCATCGGTACTTCTTCTCTTTCCTCGAGGAAAGAGAAGAAGTACCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032327.2-1068s21c1
Sequence:CCGGAGGTGAGACTAGCATCGAAAGCTCGAGCTTTCGATGCTAGTCTCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032327.2-753s21c1
Sequence:CCGGCAATTGTGTGGGCCACTATAACTCGAGTTATAGTGGCCCACACAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032327.2-650s1c1
Sequence:CCGGCCATCTGTAAGAAGTGCATTTCTCGAGAAATGCACTTCTTACAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032327.2-1130s1c1
Sequence:CCGGGCAGAGTATTTAGGAATCCTTCTCGAGAAGGATTCCTAAATACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032327.2-1503s1c1
Sequence:CCGGGAGAAATCTTAGGACTGACATCTCGAGATGTCAGTCCTAAGATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148036    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032327.2-1488s1c1
Sequence:CCGGGAAAGACACAATGTGGAGAAACTCGAGTTTCTCCACATTGTGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032327.2-830s1c1
Sequence:CCGGGCTATGGAAGTTGGGACCTTTCTCGAGAAAGGTCCCAACTTCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032327
VALIDATED
ZDHHC16 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 16
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032327.2-910s21c1
Sequence:CCGGGCGGTTGCCAACCAGACTTATCTCGAGATAAGTCTGGTTGGCAACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032327.2-554s21c1
Sequence:CCGGACTGGAATCTGATCCTGATTGCTCGAGCAATCAGGATCAGATTCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032327.2-775s21c1
Sequence:CCGCCATCGGTACTTCTTCTCTTTCCTCGAGGAAAGAGAAGAAGTACCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032327.2-1068s21c1
Sequence:CCGGAGGTGAGACTAGCATCGAAAGCTCGAGCTTTCGATGCTAGTCTCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032327.2-753s21c1
Sequence:CCGGCAATTGTGTGGGCCACTATAACTCGAGTTATAGTGGCCCACACAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032327.2-650s1c1
Sequence:CCGGCCATCTGTAAGAAGTGCATTTCTCGAGAAATGCACTTCTTACAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032327.2-1130s1c1
Sequence:CCGGGCAGAGTATTTAGGAATCCTTCTCGAGAAGGATTCCTAAATACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032327.2-1503s1c1
Sequence:CCGGGAGAAATCTTAGGACTGACATCTCGAGATGTCAGTCCTAAGATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148036    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032327.2-1488s1c1
Sequence:CCGGGAAAGACACAATGTGGAGAAACTCGAGTTTCTCCACATTGTGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032327.2-830s1c1
Sequence:CCGGGCTATGGAAGTTGGGACCTTTCTCGAGAAAGGTCCCAACTTCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023740
ZDHHC16 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 16
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023740.2-623s21c1
Sequence:CCGGCCATCGTGGCCATTGCTTATCCTCGAGGATAAGCAATGGCCACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023740.2-912s21c1
Sequence:CCGGCAACTGTGTGGGCCACTATAACTCGAGTTATAGTGGCCCACACAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023740.2-482s21c1
Sequence:CCGGTGCGCTCCCTGCTCTACAATTCTCGAGAATTGTAGAGCAGGGAGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023740.2-1433s21c1
Sequence:CCGGCCACAACTTGAACACTATTTGCTCGAGCAAATAGTGTTCAAGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023740.2-810s21c1
Sequence:CCGGCATCTGTAAGAAGTGCATTTACTCGAGTAAATGCACTTCTTACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215855    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023740.2-1433s1c1
Sequence:CCGGCCACAACTTGAACACTATTTGCTCGAGCAAATAGTGTTCAAGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023740.1-900s1c1
Sequence:CCGGCTATAACCATCGCTACTTCTTCTCGAGAAGAAGTAGCGATGGTTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023740
ZDHHC16 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 16
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023740.2-623s21c1
Sequence:CCGGCCATCGTGGCCATTGCTTATCCTCGAGGATAAGCAATGGCCACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023740.2-912s21c1
Sequence:CCGGCAACTGTGTGGGCCACTATAACTCGAGTTATAGTGGCCCACACAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023740.2-482s21c1
Sequence:CCGGTGCGCTCCCTGCTCTACAATTCTCGAGAATTGTAGAGCAGGGAGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023740.2-1433s21c1
Sequence:CCGGCCACAACTTGAACACTATTTGCTCGAGCAAATAGTGTTCAAGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023740.2-810s21c1
Sequence:CCGGCATCTGTAAGAAGTGCATTTACTCGAGTAAATGCACTTCTTACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215855    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023740.2-1433s1c1
Sequence:CCGGCCACAACTTGAACACTATTTGCTCGAGCAAATAGTGTTCAAGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023740.1-900s1c1
Sequence:CCGGCTATAACCATCGCTACTTCTTCTCGAGAAGAAGTAGCGATGGTTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023740
ZDHHC16 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 16
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023740.2-623s21c1
Sequence:CCGGCCATCGTGGCCATTGCTTATCCTCGAGGATAAGCAATGGCCACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023740.2-912s21c1
Sequence:CCGGCAACTGTGTGGGCCACTATAACTCGAGTTATAGTGGCCCACACAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023740.2-482s21c1
Sequence:CCGGTGCGCTCCCTGCTCTACAATTCTCGAGAATTGTAGAGCAGGGAGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023740.2-1433s21c1
Sequence:CCGGCCACAACTTGAACACTATTTGCTCGAGCAAATAGTGTTCAAGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023740.2-810s21c1
Sequence:CCGGCATCTGTAAGAAGTGCATTTACTCGAGTAAATGCACTTCTTACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215855    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023740.2-1433s1c1
Sequence:CCGGCCACAACTTGAACACTATTTGCTCGAGCAAATAGTGTTCAAGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023740.1-900s1c1
Sequence:CCGGCTATAACCATCGCTACTTCTTCTCGAGAAGAAGTAGCGATGGTTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks