EMAIL THIS PAGE TO A FRIEND

ZDHHC17

zinc finger, DHHC-type containing 17

Synonyms: HIP14 HIP3 HYPH
Gene ID:
Mouse(320150) zinc finger, DHHC domain containing 17
Rat(366889) zinc finger, DHHC-type containing 17
Zebrafish(100148543) zinc finger, DHHC-type containing 17
domestic cat(101084552) zinc finger, DHHC-type containing 17
Horse(100059245) zinc finger, DHHC-type containing 17
dog(482574) zinc finger, DHHC-type containing 17
chicken(417867) zinc finger, DHHC-type containing 17
Domestic Rabbit(100348308) zinc finger, DHHC-type containing 17
naked mole-rat(101704783) zinc finger, DHHC-type containing 17
domestic guinea pig(100713862) zinc finger, DHHC-type containing 17
cow(541172) zinc finger, DHHC-type containing 17
sheep(101102804) zinc finger, DHHC-type containing 17
252 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H7414 Anti-HIP14 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat, canine, bovine
western blot pricing
SAB2500508 Anti-HIP14/ZDHHC17 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
AV47141 Anti-ZDHHC17 (AB1) antibody produced in rabbit affinity isolated antibody mouse, rat, rabbit, bovine, zebrafish, human, guinea pig, horse
western blot pricing
AV47142 Anti-ZDHHC17 (AB2) antibody produced in rabbit IgG fraction of antiserum rat, horse, rabbit, mouse, guinea pig, bovine, zebrafish, human
western blot pricing
HPA016807 Anti-ZDHHC17 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015336 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015336 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015336 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172554 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172554 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172554 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015336 Rosetta Predictions human pricing
NM_001039340 Rosetta Predictions rat pricing
NM_172554 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206504 predicted 1251
2 SASI_Hs02_00347639 predicted 1782
3 SASI_Hs01_00206505 predicted 1612
4 SASI_Hs01_00206506 predicted 984
5 SASI_Hs01_00206508 predicted 1904
6 SASI_Hs01_00206509 predicted 805
7 SASI_Hs01_00206510 predicted 762
8 SASI_Hs02_00347640 predicted 265
9 SASI_Hs02_00347641 predicted 1420
10 SASI_Hs01_00206512 predicted 864
11 SASI_Hs01_00206507 predicted 480
12 SASI_Hs01_00206511 predicted 800
13 SASI_Hs01_00206513 predicted 1048
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039340 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031446 predicted 552
2 SASI_Rn01_00031447 predicted 1633
3 SASI_Rn01_00031448 predicted 941
4 SASI_Rn01_00031449 predicted 1424
5 SASI_Rn01_00031450 predicted 287
6 SASI_Rn01_00031451 predicted 1835
7 SASI_Rn01_00031452 predicted 576
8 SASI_Rn02_00204820 predicted 1730
9 SASI_Rn01_00031453 predicted 308
10 SASI_Rn01_00031454 predicted 609
11 SASI_Rn01_00031455 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172554 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087450 predicted 1188
2 SASI_Mm01_00087452 predicted 941
3 SASI_Mm01_00087453 predicted 1969
4 SASI_Mm01_00087454 predicted 964
5 SASI_Mm01_00087455 predicted 1695
6 SASI_Mm01_00087456 predicted 286
7 SASI_Mm01_00087457 predicted 572
8 SASI_Mm01_00087458 predicted 314
9 SASI_Mm01_00087459 predicted 613
10 SASI_Mm02_00344183 predicted 1634
11 SASI_Mm01_00087451 predicted 558
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015336
VALIDATED
ZDHHC17 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 17
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015336.1-1411s1c1
Sequence:CCGGCCCAGAATATCAAGGGCGAATCTCGAGATTCGCCCTTGATATTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015336.1-1356s1c1
Sequence:CCGGGCAGGGAATACCACAGTCATTCTCGAGAATGACTGTGGTATTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_015336.1-4100s1c1
Sequence:CCGGGCATGTCTGATGCTTGGTAAACTCGAGTTTACCAAGCATCAGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015336.1-3566s1c1
Sequence:CCGGGCTGACAGTATATTCTGGTTTCTCGAGAAACCAGAATATACTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_015336.1-2494s1c1
Sequence:CCGGCCAGGCAGTATACAATAGAATCTCGAGATTCTATTGTATACTGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015336.1-4872s1c1
Sequence:CCGGCCAACTATAAACCCAGTTCTACTCGAGTAGAACTGGGTTTATAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015336.1-1970s1c1
Sequence:CCGGCAGTACCTGTTTGATACGAAACTCGAGTTTCGTATCAAACAGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_015336.1-939s1c1
Sequence:CCGGGCTGCCATCAATAACAGAATACTCGAGTATTCTGTTATTGATGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015336.1-2183s1c1
Sequence:CCGGCACTTACACCAAGGATGGATTCTCGAGAATCCATCCTTGGTGTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015336.1-823s1c1
Sequence:CCGGCATGGGACATAGTCAAGGCTACTCGAGTAGCCTTGACTATGTCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015336.1-1042s1c1
Sequence:CCGGCCACAAGACAAGGCCATCTATCTCGAGATAGATGGCCTTGTCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015336.2-408s21c1
Sequence:CCGGATGTACGGCAACCGGACAAAGCTCGAGCTTTGTCCGGTTGCCGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_015336.2-1586s21c1
Sequence:CCGGGGTGCAGGCAACCATAGATATCTCGAGATATCTATGGTTGCCTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_015336.2-1828s21c1
Sequence:CCGGGATATCATGTTTAGGTATTACCTCGAGGTAATACCTAAACATGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_015336.2-1637s21c1
Sequence:GTACCGGATGATCTGCTGGATGATTTATCTCGAGATAAATCATCCAGCAGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230359    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_015336.2-2658s21c1
Sequence:CCGGCTGTTGCAATGCTGATATATTCTCGAGAATATATCAGCATTGCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015336
VALIDATED
ZDHHC17 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 17
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015336.1-1411s1c1
Sequence:CCGGCCCAGAATATCAAGGGCGAATCTCGAGATTCGCCCTTGATATTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015336.1-1356s1c1
Sequence:CCGGGCAGGGAATACCACAGTCATTCTCGAGAATGACTGTGGTATTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_015336.1-4100s1c1
Sequence:CCGGGCATGTCTGATGCTTGGTAAACTCGAGTTTACCAAGCATCAGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015336.1-3566s1c1
Sequence:CCGGGCTGACAGTATATTCTGGTTTCTCGAGAAACCAGAATATACTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_015336.1-2494s1c1
Sequence:CCGGCCAGGCAGTATACAATAGAATCTCGAGATTCTATTGTATACTGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015336.1-4872s1c1
Sequence:CCGGCCAACTATAAACCCAGTTCTACTCGAGTAGAACTGGGTTTATAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015336.1-1970s1c1
Sequence:CCGGCAGTACCTGTTTGATACGAAACTCGAGTTTCGTATCAAACAGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_015336.1-939s1c1
Sequence:CCGGGCTGCCATCAATAACAGAATACTCGAGTATTCTGTTATTGATGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015336.1-2183s1c1
Sequence:CCGGCACTTACACCAAGGATGGATTCTCGAGAATCCATCCTTGGTGTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015336.1-823s1c1
Sequence:CCGGCATGGGACATAGTCAAGGCTACTCGAGTAGCCTTGACTATGTCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015336.1-1042s1c1
Sequence:CCGGCCACAAGACAAGGCCATCTATCTCGAGATAGATGGCCTTGTCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015336.2-408s21c1
Sequence:CCGGATGTACGGCAACCGGACAAAGCTCGAGCTTTGTCCGGTTGCCGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_015336.2-1586s21c1
Sequence:CCGGGGTGCAGGCAACCATAGATATCTCGAGATATCTATGGTTGCCTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_015336.2-1828s21c1
Sequence:CCGGGATATCATGTTTAGGTATTACCTCGAGGTAATACCTAAACATGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_015336.2-1637s21c1
Sequence:GTACCGGATGATCTGCTGGATGATTTATCTCGAGATAAATCATCCAGCAGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230359    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_015336.2-2658s21c1
Sequence:CCGGCTGTTGCAATGCTGATATATTCTCGAGAATATATCAGCATTGCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015336
VALIDATED
ZDHHC17 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 17
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015336.1-1411s1c1
Sequence:CCGGCCCAGAATATCAAGGGCGAATCTCGAGATTCGCCCTTGATATTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015336.1-1356s1c1
Sequence:CCGGGCAGGGAATACCACAGTCATTCTCGAGAATGACTGTGGTATTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_015336.1-4100s1c1
Sequence:CCGGGCATGTCTGATGCTTGGTAAACTCGAGTTTACCAAGCATCAGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015336.1-3566s1c1
Sequence:CCGGGCTGACAGTATATTCTGGTTTCTCGAGAAACCAGAATATACTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_015336.1-2494s1c1
Sequence:CCGGCCAGGCAGTATACAATAGAATCTCGAGATTCTATTGTATACTGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015336.1-4872s1c1
Sequence:CCGGCCAACTATAAACCCAGTTCTACTCGAGTAGAACTGGGTTTATAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015336.1-1970s1c1
Sequence:CCGGCAGTACCTGTTTGATACGAAACTCGAGTTTCGTATCAAACAGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_015336.1-939s1c1
Sequence:CCGGGCTGCCATCAATAACAGAATACTCGAGTATTCTGTTATTGATGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015336.1-2183s1c1
Sequence:CCGGCACTTACACCAAGGATGGATTCTCGAGAATCCATCCTTGGTGTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015336.1-823s1c1
Sequence:CCGGCATGGGACATAGTCAAGGCTACTCGAGTAGCCTTGACTATGTCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015336.1-1042s1c1
Sequence:CCGGCCACAAGACAAGGCCATCTATCTCGAGATAGATGGCCTTGTCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015336.2-408s21c1
Sequence:CCGGATGTACGGCAACCGGACAAAGCTCGAGCTTTGTCCGGTTGCCGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_015336.2-1586s21c1
Sequence:CCGGGGTGCAGGCAACCATAGATATCTCGAGATATCTATGGTTGCCTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_015336.2-1828s21c1
Sequence:CCGGGATATCATGTTTAGGTATTACCTCGAGGTAATACCTAAACATGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_015336.2-1637s21c1
Sequence:GTACCGGATGATCTGCTGGATGATTTATCTCGAGATAAATCATCCAGCAGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230359    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_015336.2-2658s21c1
Sequence:CCGGCTGTTGCAATGCTGATATATTCTCGAGAATATATCAGCATTGCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172554
ZDHHC17 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 17
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172554.1-554s1c1
Sequence:CCGGCCCTTTAATGTGGGCAGCTTACTCGAGTAAGCTGCCCACATTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172554.1-2208s1c1
Sequence:CCGGCCGAGGATAAATGTCGTTATACTCGAGTATAACGACATTTATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172554.1-555s1c1
Sequence:CCGGCCTTTAATGTGGGCAGCTTATCTCGAGATAAGCTGCCCACATTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172554.1-1640s1c1
Sequence:CCGGCCAGATAACATGTTTAGGTATCTCGAGATACCTAAACATGTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172554.1-270s1c1
Sequence:CCGGGCCATCAATAACAGAATAGATCTCGAGATCTATTCTGTTATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172554
ZDHHC17 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 17
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172554.1-554s1c1
Sequence:CCGGCCCTTTAATGTGGGCAGCTTACTCGAGTAAGCTGCCCACATTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172554.1-2208s1c1
Sequence:CCGGCCGAGGATAAATGTCGTTATACTCGAGTATAACGACATTTATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172554.1-555s1c1
Sequence:CCGGCCTTTAATGTGGGCAGCTTATCTCGAGATAAGCTGCCCACATTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172554.1-1640s1c1
Sequence:CCGGCCAGATAACATGTTTAGGTATCTCGAGATACCTAAACATGTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172554.1-270s1c1
Sequence:CCGGGCCATCAATAACAGAATAGATCTCGAGATCTATTCTGTTATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172554
ZDHHC17 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 17
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172554.1-554s1c1
Sequence:CCGGCCCTTTAATGTGGGCAGCTTACTCGAGTAAGCTGCCCACATTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172554.1-2208s1c1
Sequence:CCGGCCGAGGATAAATGTCGTTATACTCGAGTATAACGACATTTATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172554.1-555s1c1
Sequence:CCGGCCTTTAATGTGGGCAGCTTATCTCGAGATAAGCTGCCCACATTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172554.1-1640s1c1
Sequence:CCGGCCAGATAACATGTTTAGGTATCTCGAGATACCTAAACATGTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172554.1-270s1c1
Sequence:CCGGGCCATCAATAACAGAATAGATCTCGAGATCTATTCTGTTATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks