EMAIL THIS PAGE TO A FRIEND

ZDHHC18

zinc finger, DHHC-type containing 18

Synonyms: DHHC-18 DHHC18
UniProtKB ID: Q9NUE0, A6NHY9, Q5JYH0, Q9H020
Gene ID:
Mouse(503610) zinc finger, DHHC domain containing 18
Rat(362613) zinc finger, DHHC-type containing 18
cow(100337343) zinc finger, DHHC-type containing 18
sheep(101115010) zinc finger, DHHC-type containing 18
domestic guinea pig(100713750) zinc finger, DHHC-type containing 18
naked mole-rat(101716501) zinc finger, DHHC-type containing 18
chicken(419575) zinc finger, DHHC-type containing 18
domestic cat(101087250) zinc finger, DHHC-type containing 18
dog(612137) zinc finger, DHHC-type containing 18
155 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017968 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001017968 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001017968 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032283 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032283 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032283 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102841 MISSION® esiRNA esiRNA human ZDHHC18 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032283 Rosetta Predictions human pricing
NM_001039339 Rosetta Predictions rat pricing
NM_001017968 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173356 predicted 1346
2 SASI_Hs01_00173357 predicted 583
3 SASI_Hs01_00173358 predicted 1346
4 SASI_Hs01_00173359 predicted 720
5 SASI_Hs01_00173360 predicted 1321
6 SASI_Hs01_00173361 predicted 1224
7 SASI_Hs01_00173362 predicted 1001
8 SASI_Hs01_00173363 predicted 1564
9 SASI_Hs01_00173364 predicted 885
10 SASI_Hs01_00173365 predicted 1469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039339 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086778 predicted 572
2 SASI_Rn01_00086779 predicted 857
3 SASI_Rn01_00086780 predicted 900
4 SASI_Rn01_00086781 predicted 828
5 SASI_Rn01_00086782 predicted 958
6 SASI_Rn01_00086783 predicted 559
7 SASI_Rn01_00086784 predicted 559
8 SASI_Rn01_00086785 predicted 665
9 SASI_Rn01_00086786 predicted 801
10 SASI_Rn01_00086787 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017968 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287519 predicted 1079
2 SASI_Mm02_00287520 predicted 1461
3 SASI_Mm01_00192286 predicted 834
4 SASI_Mm01_00192287 predicted 862
5 SASI_Mm02_00287521 predicted 1597
6 SASI_Mm02_00287522 predicted 391
7 SASI_Mm01_00192291 predicted 842
8 SASI_Mm02_00287523 predicted 1542
9 SASI_Mm02_00287524 predicted 1622
10 SASI_Mm02_00287525 predicted 1342
11 SASI_Mm01_00192288 predicted 510
12 SASI_Mm01_00192289 predicted 231
13 SASI_Mm01_00192290 predicted 489
14 SASI_Mm01_00192292 predicted 229
15 SASI_Mm01_00192293 predicted 516
16 SASI_Mm01_00192294 predicted 397
17 SASI_Mm01_00192295 predicted 371
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017968
VALIDATED
ZDHHC18 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 18
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017968.1-513s1c1
Sequence:CCGGCCTGACAACTAACGAAGATATCTCGAGATATCTTCGTTAGTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017968.1-153s1c1
Sequence:CCGGGCAGACAGTGAAACTCAAGTACTCGAGTACTTGAGTTTCACTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017968.1-286s1c1
Sequence:CCGGAGACGGAACTACCGCTTCTTTCTCGAGAAAGAAGCGGTAGTTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017968.1-371s1c1
Sequence:CCGGTGACCCTTCTTTCTCAAGGAACTCGAGTTCCTTGAGAAAGAAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017968.1-229s1c1
Sequence:CCGGGACAACTGTGTGGAACGGTTTCTCGAGAAACCGTTCCACACAGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017968
VALIDATED
ZDHHC18 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 18
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017968.1-513s1c1
Sequence:CCGGCCTGACAACTAACGAAGATATCTCGAGATATCTTCGTTAGTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017968.1-153s1c1
Sequence:CCGGGCAGACAGTGAAACTCAAGTACTCGAGTACTTGAGTTTCACTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017968.1-286s1c1
Sequence:CCGGAGACGGAACTACCGCTTCTTTCTCGAGAAAGAAGCGGTAGTTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017968.1-371s1c1
Sequence:CCGGTGACCCTTCTTTCTCAAGGAACTCGAGTTCCTTGAGAAAGAAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017968.1-229s1c1
Sequence:CCGGGACAACTGTGTGGAACGGTTTCTCGAGAAACCGTTCCACACAGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017968
VALIDATED
ZDHHC18 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 18
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017968.1-513s1c1
Sequence:CCGGCCTGACAACTAACGAAGATATCTCGAGATATCTTCGTTAGTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017968.1-153s1c1
Sequence:CCGGGCAGACAGTGAAACTCAAGTACTCGAGTACTTGAGTTTCACTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017968.1-286s1c1
Sequence:CCGGAGACGGAACTACCGCTTCTTTCTCGAGAAAGAAGCGGTAGTTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017968.1-371s1c1
Sequence:CCGGTGACCCTTCTTTCTCAAGGAACTCGAGTTCCTTGAGAAAGAAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017968.1-229s1c1
Sequence:CCGGGACAACTGTGTGGAACGGTTTCTCGAGAAACCGTTCCACACAGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032283
VALIDATED
ZDHHC18 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 18
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032283.1-419s1c1
Sequence:CCGGCTTCGTCTTTGACTGTCCCTACTCGAGTAGGGACAGTCAAAGACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032283.1-728s1c1
Sequence:CCGGCGACAACTGTGTGGAACGATTCTCGAGAATCGTTCCACACAGTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032283.1-1016s1c1
Sequence:CCGGGACTACTAATGAAGACATCAACTCGAGTTGATGTCTTCATTAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032283.1-2059s1c1
Sequence:CCGGGCAATACTTGAAACGGGTTTACTCGAGTAAACCCGTTTCAAGTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_032283.1-812s1c1
Sequence:CCGGGTTTATTCTCTCCCTCTCATTCTCGAGAATGAGAGGGAGAGAATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_032283.1-1866s1c1
Sequence:CCGGCCTGTATCAGACAAAGGTAAACTCGAGTTTACCTTTGTCTGATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160503    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032283.1-1736s1c1
Sequence:CCGGCCTTGGTGATAATTTCCCTTTCTCGAGAAAGGGAAATTATCACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032283.1-579s1c1
Sequence:CCGGGAGAAACAGATCGACAACACACTCGAGTGTGTTGTCGATCTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164822    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032283.1-2772s1c1
Sequence:CCGGCCGGAAACTCAGAGGATGTTTCTCGAGAAACATCCTCTGAGTTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032283.1-785s1c1
Sequence:CCGGGAGACGGAACTATCGCTTCTTCTCGAGAAGAAGCGATAGTTCCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032283.1-810s1c1
Sequence:CCGGGCGTTTATTCTCTCCCTCTCACTCGAGTGAGAGGGAGAGAATAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032283.1-653s1c1
Sequence:CCGGGCAGATGGTGAAGCTGAAGTACTCGAGTACTTCAGCTTCACCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032283
VALIDATED
ZDHHC18 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 18
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032283.1-419s1c1
Sequence:CCGGCTTCGTCTTTGACTGTCCCTACTCGAGTAGGGACAGTCAAAGACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032283.1-728s1c1
Sequence:CCGGCGACAACTGTGTGGAACGATTCTCGAGAATCGTTCCACACAGTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032283.1-1016s1c1
Sequence:CCGGGACTACTAATGAAGACATCAACTCGAGTTGATGTCTTCATTAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032283.1-2059s1c1
Sequence:CCGGGCAATACTTGAAACGGGTTTACTCGAGTAAACCCGTTTCAAGTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_032283.1-812s1c1
Sequence:CCGGGTTTATTCTCTCCCTCTCATTCTCGAGAATGAGAGGGAGAGAATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_032283.1-1866s1c1
Sequence:CCGGCCTGTATCAGACAAAGGTAAACTCGAGTTTACCTTTGTCTGATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160503    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032283.1-1736s1c1
Sequence:CCGGCCTTGGTGATAATTTCCCTTTCTCGAGAAAGGGAAATTATCACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032283.1-579s1c1
Sequence:CCGGGAGAAACAGATCGACAACACACTCGAGTGTGTTGTCGATCTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164822    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032283.1-2772s1c1
Sequence:CCGGCCGGAAACTCAGAGGATGTTTCTCGAGAAACATCCTCTGAGTTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032283.1-785s1c1
Sequence:CCGGGAGACGGAACTATCGCTTCTTCTCGAGAAGAAGCGATAGTTCCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032283.1-810s1c1
Sequence:CCGGGCGTTTATTCTCTCCCTCTCACTCGAGTGAGAGGGAGAGAATAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032283.1-653s1c1
Sequence:CCGGGCAGATGGTGAAGCTGAAGTACTCGAGTACTTCAGCTTCACCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032283
VALIDATED
ZDHHC18 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 18
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032283.1-419s1c1
Sequence:CCGGCTTCGTCTTTGACTGTCCCTACTCGAGTAGGGACAGTCAAAGACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032283.1-728s1c1
Sequence:CCGGCGACAACTGTGTGGAACGATTCTCGAGAATCGTTCCACACAGTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032283.1-1016s1c1
Sequence:CCGGGACTACTAATGAAGACATCAACTCGAGTTGATGTCTTCATTAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032283.1-2059s1c1
Sequence:CCGGGCAATACTTGAAACGGGTTTACTCGAGTAAACCCGTTTCAAGTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_032283.1-812s1c1
Sequence:CCGGGTTTATTCTCTCCCTCTCATTCTCGAGAATGAGAGGGAGAGAATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_032283.1-1866s1c1
Sequence:CCGGCCTGTATCAGACAAAGGTAAACTCGAGTTTACCTTTGTCTGATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160503    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032283.1-1736s1c1
Sequence:CCGGCCTTGGTGATAATTTCCCTTTCTCGAGAAAGGGAAATTATCACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032283.1-579s1c1
Sequence:CCGGGAGAAACAGATCGACAACACACTCGAGTGTGTTGTCGATCTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164822    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032283.1-2772s1c1
Sequence:CCGGCCGGAAACTCAGAGGATGTTTCTCGAGAAACATCCTCTGAGTTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032283.1-785s1c1
Sequence:CCGGGAGACGGAACTATCGCTTCTTCTCGAGAAGAAGCGATAGTTCCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032283.1-810s1c1
Sequence:CCGGGCGTTTATTCTCTCCCTCTCACTCGAGTGAGAGGGAGAGAATAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032283.1-653s1c1
Sequence:CCGGGCAGATGGTGAAGCTGAAGTACTCGAGTACTTCAGCTTCACCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks