EMAIL THIS PAGE TO A FRIEND

ZDHHC19

zinc finger, DHHC-type containing 19

Synonyms: DHHC19
UniProtKB ID: Q8WVZ1, A8MSY6
Gene ID:
Mouse(245308) zinc finger, DHHC domain containing 19
Rat(288045) zinc finger, DHHC-type containing 19
dog(609406) zinc finger, DHHC-type containing 19
naked mole-rat(101704371) zinc finger, DHHC-type containing 19
domestic guinea pig(100724044) zinc finger, DHHC-type containing 19
cow(514466) zinc finger, DHHC-type containing 19
sheep(101120289) zinc finger, DHHC-type containing 19
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199309 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199309 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199309 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144637 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144637 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144637 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039617 Rosetta Predictions human pricing
NM_001039259 Rosetta Predictions rat pricing
NM_199309 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212346 predicted 928
2 SASI_Hs01_00212347 predicted 675
3 SASI_Hs01_00212348 predicted 842
4 SASI_Hs01_00212349 predicted 872
5 SASI_Hs01_00212350 predicted 350
6 SASI_Hs01_00212351 predicted 560
7 SASI_Hs01_00212352 predicted 941
8 SASI_Hs01_00212354 predicted 531
9 SASI_Hs02_00308607 predicted 332
10 SASI_Hs01_00212355 predicted 988
11 SASI_Hs01_00212353 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039259 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056069 predicted 820
2 SASI_Rn01_00056070 predicted 1150
3 SASI_Rn01_00056071 predicted 854
4 SASI_Rn01_00056072 predicted 559
5 SASI_Rn01_00056073 predicted 1152
6 SASI_Rn01_00056074 predicted 1065
7 SASI_Rn01_00056075 predicted 1103
8 SASI_Rn01_00056076 predicted 755
9 SASI_Rn01_00056077 predicted 1146
10 SASI_Rn01_00056078 predicted 557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199309 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085741 predicted 828
2 SASI_Mm01_00085743 predicted 1029
3 SASI_Mm01_00085744 predicted 902
4 SASI_Mm01_00085745 predicted 222
5 SASI_Mm01_00085746 predicted 877
6 SASI_Mm01_00085747 predicted 356
7 SASI_Mm01_00085748 predicted 979
8 SASI_Mm01_00085749 predicted 864
9 SASI_Mm02_00351438 predicted 526
10 SASI_Mm01_00085750 predicted 862
11 SASI_Mm01_00085742 predicted 286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199309
ZDHHC19 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 19
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199309.1-910s1c1
Sequence:CCGGCCCAATTACATGTCTGAAGTTCTCGAGAACTTCAGACATGTAATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199309.1-923s1c1
Sequence:CCGGCTGAAGTTGTCTGTCTGCAAACTCGAGTTTGCAGACAGACAACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199309.1-873s1c1
Sequence:CCGGCAAGAACTGGTATCTGGCAATCTCGAGATTGCCAGATACCAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199309.1-831s1c1
Sequence:CCGGCAGGTACCATCCGGAATACAACTCGAGTTGTATTCCGGATGGTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199309.2-435s21c1
Sequence:CCGGGGTGCATGTTGTTCGAGTGAACTCGAGTTCACTCGAACAACATGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199309.2-365s21c1
Sequence:CCGGGTCTCGTCTCGCTCAACTTCTCTCGAGAGAAGTTGAGCGAGACGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199309
ZDHHC19 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 19
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199309.1-910s1c1
Sequence:CCGGCCCAATTACATGTCTGAAGTTCTCGAGAACTTCAGACATGTAATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199309.1-923s1c1
Sequence:CCGGCTGAAGTTGTCTGTCTGCAAACTCGAGTTTGCAGACAGACAACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199309.1-873s1c1
Sequence:CCGGCAAGAACTGGTATCTGGCAATCTCGAGATTGCCAGATACCAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199309.1-831s1c1
Sequence:CCGGCAGGTACCATCCGGAATACAACTCGAGTTGTATTCCGGATGGTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199309.2-435s21c1
Sequence:CCGGGGTGCATGTTGTTCGAGTGAACTCGAGTTCACTCGAACAACATGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199309.2-365s21c1
Sequence:CCGGGTCTCGTCTCGCTCAACTTCTCTCGAGAGAAGTTGAGCGAGACGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199309
ZDHHC19 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 19
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199309.1-910s1c1
Sequence:CCGGCCCAATTACATGTCTGAAGTTCTCGAGAACTTCAGACATGTAATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199309.1-923s1c1
Sequence:CCGGCTGAAGTTGTCTGTCTGCAAACTCGAGTTTGCAGACAGACAACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199309.1-873s1c1
Sequence:CCGGCAAGAACTGGTATCTGGCAATCTCGAGATTGCCAGATACCAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199309.1-831s1c1
Sequence:CCGGCAGGTACCATCCGGAATACAACTCGAGTTGTATTCCGGATGGTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199309.2-435s21c1
Sequence:CCGGGGTGCATGTTGTTCGAGTGAACTCGAGTTCACTCGAACAACATGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199309.2-365s21c1
Sequence:CCGGGTCTCGTCTCGCTCAACTTCTCTCGAGAGAAGTTGAGCGAGACGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144637
ZDHHC19 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 19
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144637.2-301s1c1
Sequence:CCGGGTTATCACAGGCTCCCTCTTTCTCGAGAAAGAGGGAGCCTGTGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144637.2-293s1c1
Sequence:CCGGCCTTTCCTGTTATCACAGGCTCTCGAGAGCCTGTGATAACAGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144637.2-845s1c1
Sequence:CCGGCCAGCAACTGGTATTTAACAACTCGAGTTGTTAAATACCAGTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144637.2-325s1c1
Sequence:CCGGCTTACCTTCTTCAGTCTTGTTCTCGAGAACAAGACTGAAGAAGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144637.2-844s1c1
Sequence:CCGGGCCAGCAACTGGTATTTAACACTCGAGTGTTAAATACCAGTTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144637.2-540s1c1
Sequence:CCGGCAAGTGGGTCAATAACTGCATCTCGAGATGCAGTTATTGACCCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144637.2-365s1c1
Sequence:CCGGCTGGCATCTTACATCAAGGCTCTCGAGAGCCTTGATGTAAGATGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144637.2-314s1c1
Sequence:CCGGCCCTCTTTGTCCTTACCTTCTCTCGAGAGAAGGTAAGGACAAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144637
ZDHHC19 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 19
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144637.2-301s1c1
Sequence:CCGGGTTATCACAGGCTCCCTCTTTCTCGAGAAAGAGGGAGCCTGTGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144637.2-293s1c1
Sequence:CCGGCCTTTCCTGTTATCACAGGCTCTCGAGAGCCTGTGATAACAGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144637.2-845s1c1
Sequence:CCGGCCAGCAACTGGTATTTAACAACTCGAGTTGTTAAATACCAGTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144637.2-325s1c1
Sequence:CCGGCTTACCTTCTTCAGTCTTGTTCTCGAGAACAAGACTGAAGAAGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144637.2-844s1c1
Sequence:CCGGGCCAGCAACTGGTATTTAACACTCGAGTGTTAAATACCAGTTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144637.2-540s1c1
Sequence:CCGGCAAGTGGGTCAATAACTGCATCTCGAGATGCAGTTATTGACCCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144637.2-365s1c1
Sequence:CCGGCTGGCATCTTACATCAAGGCTCTCGAGAGCCTTGATGTAAGATGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144637.2-314s1c1
Sequence:CCGGCCCTCTTTGTCCTTACCTTCTCTCGAGAGAAGGTAAGGACAAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144637
ZDHHC19 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 19
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144637.2-301s1c1
Sequence:CCGGGTTATCACAGGCTCCCTCTTTCTCGAGAAAGAGGGAGCCTGTGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144637.2-293s1c1
Sequence:CCGGCCTTTCCTGTTATCACAGGCTCTCGAGAGCCTGTGATAACAGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144637.2-845s1c1
Sequence:CCGGCCAGCAACTGGTATTTAACAACTCGAGTTGTTAAATACCAGTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144637.2-325s1c1
Sequence:CCGGCTTACCTTCTTCAGTCTTGTTCTCGAGAACAAGACTGAAGAAGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144637.2-844s1c1
Sequence:CCGGGCCAGCAACTGGTATTTAACACTCGAGTGTTAAATACCAGTTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144637.2-540s1c1
Sequence:CCGGCAAGTGGGTCAATAACTGCATCTCGAGATGCAGTTATTGACCCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144637.2-365s1c1
Sequence:CCGGCTGGCATCTTACATCAAGGCTCTCGAGAGCCTTGATGTAAGATGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144637.2-314s1c1
Sequence:CCGGCCCTCTTTGTCCTTACCTTCTCTCGAGAGAAGGTAAGGACAAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks