EMAIL THIS PAGE TO A FRIEND

ZDHHC1

zinc finger, DHHC-type containing 1

Synonyms: C16orf1 HSU90653 ZNF377
UniProtKB ID: Q8WTX9, O15461
Gene ID:
Mouse(70796) zinc finger, DHHC domain containing 1
Rat(291967) zinc finger, DHHC-type containing 1
cow(517066) zinc finger, DHHC-type containing 1
sheep(101108247) zinc finger, DHHC-type containing 1
domestic guinea pig(100730745) zinc finger, DHHC-type containing 1
naked mole-rat(101713061) zinc finger, DHHC-type containing 1
chicken(769748) zinc finger, DHHC-type containing 1
domestic cat(101100353) zinc finger, DHHC-type containing 1
dog(479686) zinc finger, DHHC-type containing 1
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013304 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013304 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013304 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175160 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175160 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175160 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013304 Rosetta Predictions human pricing
NM_001039099 Rosetta Predictions rat pricing
NM_175160 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013304 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017814 predicted 862
2 SASI_Hs01_00017815 predicted 848
3 SASI_Hs01_00017816 predicted 919
4 SASI_Hs02_00344583 predicted 1244
5 SASI_Hs01_00017818 predicted 969
6 SASI_Hs01_00017819 predicted 996
7 SASI_Hs02_00344584 predicted 965
8 SASI_Hs01_00017821 predicted 1226
9 SASI_Hs01_00017822 predicted 640
10 SASI_Hs01_00017823 predicted 577
11 SASI_Hs01_00017817 predicted 1151
12 SASI_Hs01_00017820 predicted 1225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039099 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204795 predicted 1084
2 SASI_Rn01_00121304 predicted 1655
3 SASI_Rn01_00121305 predicted 788
4 SASI_Rn01_00121306 predicted 750
5 SASI_Rn01_00121308 predicted 615
6 SASI_Rn01_00121309 predicted 809
7 SASI_Rn01_00121310 predicted 281
8 SASI_Rn01_00121311 predicted 543
9 SASI_Rn01_00121312 predicted 1213
10 SASI_Rn01_00121313 predicted 742
11 SASI_Rn01_00121307 predicted 864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175160 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345796 predicted 1229
2 SASI_Mm01_00198648 predicted 1197
3 SASI_Mm01_00198649 predicted 1465
4 SASI_Mm01_00198650 predicted 891
5 SASI_Mm01_00198651 predicted 835
6 SASI_Mm01_00198652 predicted 681
7 SASI_Mm01_00198653 predicted 1445
8 SASI_Mm01_00198654 predicted 1050
9 SASI_Mm01_00198655 predicted 1361
10 SASI_Mm01_00198656 predicted 1795
11 SASI_Mm01_00198657 predicted 1058
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013304
ZDHHC1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013304.2-495s21c1
Sequence:CCGGTGATCGGCTTTGGGATCCTTGCTCGAGCAAGGATCCCAAAGCCGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013304.2-846s21c1
Sequence:CCGGACAGTGTTGCATCCGCTTTACCTCGAGGTAAAGCGGATGCAACACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013304.2-1479s21c1
Sequence:CCGGGAGGAAGAGGCGCGTGTATAACTCGAGTTATACACGCGCCTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013304.1-1119s1c1
Sequence:CCGGCCTGCTCTGCTTCCACATTTACTCGAGTAAATGTGGAAGCAGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013304.1-706s1c1
Sequence:CCGGCAGCACGCACATGTCATTGAACTCGAGTTCAATGACATGTGCGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013304.1-822s1c1
Sequence:CCGGCAAGTGGCTCAACAACTGTGTCTCGAGACACAGTTGTTGAGCCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013304.1-1127s1c1
Sequence:CCGGGCTTCCACATTTATCTCATGTCTCGAGACATGAGATAAATGTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013304.1-921s1c1
Sequence:CCGGCACATATGTCTTCGTGGAGTTCTCGAGAACTCCACGAAGACATATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013304.1-1134s1c1
Sequence:CCGGCATTTATCTCATGTGGCACAACTCGAGTTGTGCCACATGAGATAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013304.1-930s1c1
Sequence:CCGGCTTCGTGGAGTTCTTTGTCAACTCGAGTTGACAAAGAACTCCACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013304.1-1251s1c1
Sequence:CCGGCATTCAGGAGATGGAGTTCTACTCGAGTAGAACTCCATCTCCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013304
ZDHHC1 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013304.2-495s21c1
Sequence:CCGGTGATCGGCTTTGGGATCCTTGCTCGAGCAAGGATCCCAAAGCCGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013304.2-846s21c1
Sequence:CCGGACAGTGTTGCATCCGCTTTACCTCGAGGTAAAGCGGATGCAACACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013304.2-1479s21c1
Sequence:CCGGGAGGAAGAGGCGCGTGTATAACTCGAGTTATACACGCGCCTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013304.1-1119s1c1
Sequence:CCGGCCTGCTCTGCTTCCACATTTACTCGAGTAAATGTGGAAGCAGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013304.1-706s1c1
Sequence:CCGGCAGCACGCACATGTCATTGAACTCGAGTTCAATGACATGTGCGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013304.1-822s1c1
Sequence:CCGGCAAGTGGCTCAACAACTGTGTCTCGAGACACAGTTGTTGAGCCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013304.1-1127s1c1
Sequence:CCGGGCTTCCACATTTATCTCATGTCTCGAGACATGAGATAAATGTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013304.1-921s1c1
Sequence:CCGGCACATATGTCTTCGTGGAGTTCTCGAGAACTCCACGAAGACATATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013304.1-1134s1c1
Sequence:CCGGCATTTATCTCATGTGGCACAACTCGAGTTGTGCCACATGAGATAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013304.1-930s1c1
Sequence:CCGGCTTCGTGGAGTTCTTTGTCAACTCGAGTTGACAAAGAACTCCACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013304.1-1251s1c1
Sequence:CCGGCATTCAGGAGATGGAGTTCTACTCGAGTAGAACTCCATCTCCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013304
ZDHHC1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013304.2-495s21c1
Sequence:CCGGTGATCGGCTTTGGGATCCTTGCTCGAGCAAGGATCCCAAAGCCGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013304.2-846s21c1
Sequence:CCGGACAGTGTTGCATCCGCTTTACCTCGAGGTAAAGCGGATGCAACACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013304.2-1479s21c1
Sequence:CCGGGAGGAAGAGGCGCGTGTATAACTCGAGTTATACACGCGCCTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013304.1-1119s1c1
Sequence:CCGGCCTGCTCTGCTTCCACATTTACTCGAGTAAATGTGGAAGCAGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013304.1-706s1c1
Sequence:CCGGCAGCACGCACATGTCATTGAACTCGAGTTCAATGACATGTGCGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013304.1-822s1c1
Sequence:CCGGCAAGTGGCTCAACAACTGTGTCTCGAGACACAGTTGTTGAGCCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013304.1-1127s1c1
Sequence:CCGGGCTTCCACATTTATCTCATGTCTCGAGACATGAGATAAATGTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013304.1-921s1c1
Sequence:CCGGCACATATGTCTTCGTGGAGTTCTCGAGAACTCCACGAAGACATATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013304.1-1134s1c1
Sequence:CCGGCATTTATCTCATGTGGCACAACTCGAGTTGTGCCACATGAGATAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013304.1-930s1c1
Sequence:CCGGCTTCGTGGAGTTCTTTGTCAACTCGAGTTGACAAAGAACTCCACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013304.1-1251s1c1
Sequence:CCGGCATTCAGGAGATGGAGTTCTACTCGAGTAGAACTCCATCTCCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175160
ZDHHC1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175160.2-1205s1c1
Sequence:CCGGCCTGCTCTGCTTCCACATTTACTCGAGTAAATGTGGAAGCAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175160.2-1701s1c1
Sequence:CCGGGCTGAGTCCATGGAAGAGATTCTCGAGAATCTCTTCCATGGACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175160.2-868s1c1
Sequence:CCGGGCGCCTGCAATAAGTGCGTATCTCGAGATACGCACTTATTGCAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175160.2-1241s1c1
Sequence:CCGGGCTCACCACCTATGAATACATCTCGAGATGTATTCATAGGTGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175160.2-1238s1c1
Sequence:CCGGCAAGCTCACCACCTATGAATACTCGAGTATTCATAGGTGGTGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175160
ZDHHC1 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175160.2-1205s1c1
Sequence:CCGGCCTGCTCTGCTTCCACATTTACTCGAGTAAATGTGGAAGCAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175160.2-1701s1c1
Sequence:CCGGGCTGAGTCCATGGAAGAGATTCTCGAGAATCTCTTCCATGGACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175160.2-868s1c1
Sequence:CCGGGCGCCTGCAATAAGTGCGTATCTCGAGATACGCACTTATTGCAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175160.2-1241s1c1
Sequence:CCGGGCTCACCACCTATGAATACATCTCGAGATGTATTCATAGGTGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175160.2-1238s1c1
Sequence:CCGGCAAGCTCACCACCTATGAATACTCGAGTATTCATAGGTGGTGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175160
ZDHHC1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175160.2-1205s1c1
Sequence:CCGGCCTGCTCTGCTTCCACATTTACTCGAGTAAATGTGGAAGCAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175160.2-1701s1c1
Sequence:CCGGGCTGAGTCCATGGAAGAGATTCTCGAGAATCTCTTCCATGGACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175160.2-868s1c1
Sequence:CCGGGCGCCTGCAATAAGTGCGTATCTCGAGATACGCACTTATTGCAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175160.2-1241s1c1
Sequence:CCGGGCTCACCACCTATGAATACATCTCGAGATGTATTCATAGGTGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175160.2-1238s1c1
Sequence:CCGGCAAGCTCACCACCTATGAATACTCGAGTATTCATAGGTGGTGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks