EMAIL THIS PAGE TO A FRIEND

ZDHHC20

zinc finger, DHHC-type containing 20

UniProtKB ID: Q5W0Z9, A8MTV9, C9JG20, Q6NVU8
Gene ID:
Mouse(75965) zinc finger, DHHC domain containing 20
Rat(305923) zinc finger, DHHC-type containing 20
chicken(418947) zinc finger, DHHC-type containing 20
domestic cat(101084079) zinc finger, DHHC-type containing 20
dog(486045) zinc finger, DHHC-type containing 20
naked mole-rat(101702786) zinc finger, DHHC-type containing 20
Domestic Rabbit(100356108) zinc finger, DHHC-type containing 20
domestic guinea pig(100726782) zinc finger, DHHC-type containing 20
cow(615659) zinc finger, DHHC-type containing 20
sheep(101117089) zinc finger, DHHC-type containing 20
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153251 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153251 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153251 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029492 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029492 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029492 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013901 MISSION® esiRNA esiRNA targeting human ZDHHC20 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153251 Rosetta Predictions human pricing
NM_001039336 Rosetta Predictions rat pricing
NM_029492 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153251 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025079 predicted 364
2 SASI_Hs01_00025080 predicted 1153
3 SASI_Hs01_00025082 predicted 1141
4 SASI_Hs01_00025083 predicted 264
5 SASI_Hs01_00025084 predicted 934
6 SASI_Hs01_00025085 predicted 583
7 SASI_Hs02_00367111 predicted 1033
8 SASI_Hs01_00025086 predicted 1025
9 SASI_Hs01_00025087 predicted 1154
10 SASI_Hs01_00025088 predicted 1074
11 SASI_Hs01_00025081 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039336 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204815 predicted 878
2 SASI_Rn01_00062652 predicted 1230
3 SASI_Rn01_00062653 predicted 1191
4 SASI_Rn01_00062654 predicted 1146
5 SASI_Rn01_00062655 predicted 410
6 SASI_Rn01_00062656 predicted 998
7 SASI_Rn01_00062657 predicted 1276
8 SASI_Rn01_00062658 predicted 1091
9 SASI_Rn01_00062659 predicted 627
10 SASI_Rn01_00062660 predicted 760
11 SASI_Rn01_00062661 predicted 912
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029492 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335420 predicted 1141
2 SASI_Mm02_00335421 predicted 442
3 SASI_Mm02_00335422 predicted 1282
4 SASI_Mm02_00335423 predicted 242
5 SASI_Mm02_00335424 predicted 408
6 SASI_Mm02_00335425 predicted 282
7 SASI_Mm02_00335426 predicted 1205
8 SASI_Mm02_00335427 predicted 1028
9 SASI_Mm02_00335428 predicted 320
10 SASI_Mm02_00335429 predicted 1182
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153251
VALIDATED
ZDHHC20 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 20
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_153251.2-1361s1c1
Sequence:CCGGGCATTGACTTAGAGCTACAAACTCGAGTTTGTAGCTCTAAGTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144807    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_153251.2-1323s1c1
Sequence:CCGGGCAGAATGATGCCTTAATCTTCTCGAGAAGATTAAGGCATCATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153251.2-755s1c1
Sequence:CCGGCTTTGTGTCTGCAATGTTCTTCTCGAGAAGAACATTGCAGACACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153251.2-265s1c1
Sequence:CCGGCCGTTGTTTACCTTGTGGCTTCTCGAGAAGCCACAAGGTAAACAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153251.2-1318s1c1
Sequence:CCGGCCAGAGCAGAATGATGCCTTACTCGAGTAAGGCATCATTCTGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153251.2-1050s1c1
Sequence:CCGGGCCAGAAGTGGCTCAAATCAACTCGAGTTGATTTGAGCCACTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_153251.2-539s1c1
Sequence:CCGGCTCAGCCTGTGACTCATGTATCTCGAGATACATGAGTCACAGGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153251.2-1054s1c1
Sequence:CCGGGAAGTGGCTCAAATCAACCTTCTCGAGAAGGTTGATTTGAGCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_153251.2-356s1c1
Sequence:CCGGCAAAGAGTTCTACTTGTCCAACTCGAGTTGGACAAGTAGAACTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_153251.2-1156s1c1
Sequence:CCGGGCATCGTCAAATCAGGTGTATCTCGAGATACACCTGATTTGACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153251
VALIDATED
ZDHHC20 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 20
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_153251.2-1361s1c1
Sequence:CCGGGCATTGACTTAGAGCTACAAACTCGAGTTTGTAGCTCTAAGTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144807    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_153251.2-1323s1c1
Sequence:CCGGGCAGAATGATGCCTTAATCTTCTCGAGAAGATTAAGGCATCATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153251.2-755s1c1
Sequence:CCGGCTTTGTGTCTGCAATGTTCTTCTCGAGAAGAACATTGCAGACACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153251.2-265s1c1
Sequence:CCGGCCGTTGTTTACCTTGTGGCTTCTCGAGAAGCCACAAGGTAAACAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153251.2-1318s1c1
Sequence:CCGGCCAGAGCAGAATGATGCCTTACTCGAGTAAGGCATCATTCTGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153251.2-1050s1c1
Sequence:CCGGGCCAGAAGTGGCTCAAATCAACTCGAGTTGATTTGAGCCACTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_153251.2-539s1c1
Sequence:CCGGCTCAGCCTGTGACTCATGTATCTCGAGATACATGAGTCACAGGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153251.2-1054s1c1
Sequence:CCGGGAAGTGGCTCAAATCAACCTTCTCGAGAAGGTTGATTTGAGCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_153251.2-356s1c1
Sequence:CCGGCAAAGAGTTCTACTTGTCCAACTCGAGTTGGACAAGTAGAACTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_153251.2-1156s1c1
Sequence:CCGGGCATCGTCAAATCAGGTGTATCTCGAGATACACCTGATTTGACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153251
VALIDATED
ZDHHC20 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 20
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_153251.2-1361s1c1
Sequence:CCGGGCATTGACTTAGAGCTACAAACTCGAGTTTGTAGCTCTAAGTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144807    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_153251.2-1323s1c1
Sequence:CCGGGCAGAATGATGCCTTAATCTTCTCGAGAAGATTAAGGCATCATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153251.2-755s1c1
Sequence:CCGGCTTTGTGTCTGCAATGTTCTTCTCGAGAAGAACATTGCAGACACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153251.2-265s1c1
Sequence:CCGGCCGTTGTTTACCTTGTGGCTTCTCGAGAAGCCACAAGGTAAACAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153251.2-1318s1c1
Sequence:CCGGCCAGAGCAGAATGATGCCTTACTCGAGTAAGGCATCATTCTGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153251.2-1050s1c1
Sequence:CCGGGCCAGAAGTGGCTCAAATCAACTCGAGTTGATTTGAGCCACTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_153251.2-539s1c1
Sequence:CCGGCTCAGCCTGTGACTCATGTATCTCGAGATACATGAGTCACAGGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153251.2-1054s1c1
Sequence:CCGGGAAGTGGCTCAAATCAACCTTCTCGAGAAGGTTGATTTGAGCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_153251.2-356s1c1
Sequence:CCGGCAAAGAGTTCTACTTGTCCAACTCGAGTTGGACAAGTAGAACTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_153251.2-1156s1c1
Sequence:CCGGGCATCGTCAAATCAGGTGTATCTCGAGATACACCTGATTTGACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029492
VALIDATED
ZDHHC20 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 20
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029492.3-174s1c1
Sequence:CCGGCCATCTGTTCTTTGTTATGTTCTCGAGAACATAACAAAGAACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029492.3-973s1c1
Sequence:CCGGAGTGACTACGTCAGAAGTATTCTCGAGAATACTTCTGACGTAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029492.3-625s1c1
Sequence:CCGGCCAAAGAATGAACCAACAGTTCTCGAGAACTGTTGGTTCATTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029492.3-152s1c1
Sequence:CCGGCCGTTGTTTACCTTGTGGCTTCTCGAGAAGCCACAAGGTAAACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029492.3-602s1c1
Sequence:CCGGGCAGGAAATCTACAGAGAATTCTCGAGAATTCTCTGTAGATTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029492.4-444s21c1
Sequence:CCGGCTTCAAAGGCTATCCGATATTCTCGAGAATATCGGATAGCCTTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029492.4-756s21c1
Sequence:CCGGTCAGTGTGCTCTCACTATTTACTCGAGTAAATAGTGAGAGCACACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029492.4-1141s21c1
Sequence:CCGGCACCAAATCAGGGACAAATAACTCGAGTTATTTGTCCCTGATTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029492.4-1215s21c1
Sequence:CCGGTTGATGAGTGCAAGGTATATACTCGAGTATATACCTTGCACTCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029492.4-189s21c1
Sequence:CCGGAGCTGTGCGTGAGTACTATTTCTCGAGAAATAGTACTCACGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029492
VALIDATED
ZDHHC20 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 20
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029492.3-174s1c1
Sequence:CCGGCCATCTGTTCTTTGTTATGTTCTCGAGAACATAACAAAGAACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029492.3-973s1c1
Sequence:CCGGAGTGACTACGTCAGAAGTATTCTCGAGAATACTTCTGACGTAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029492.3-625s1c1
Sequence:CCGGCCAAAGAATGAACCAACAGTTCTCGAGAACTGTTGGTTCATTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029492.3-152s1c1
Sequence:CCGGCCGTTGTTTACCTTGTGGCTTCTCGAGAAGCCACAAGGTAAACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029492.3-602s1c1
Sequence:CCGGGCAGGAAATCTACAGAGAATTCTCGAGAATTCTCTGTAGATTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029492.4-444s21c1
Sequence:CCGGCTTCAAAGGCTATCCGATATTCTCGAGAATATCGGATAGCCTTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029492.4-756s21c1
Sequence:CCGGTCAGTGTGCTCTCACTATTTACTCGAGTAAATAGTGAGAGCACACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029492.4-1141s21c1
Sequence:CCGGCACCAAATCAGGGACAAATAACTCGAGTTATTTGTCCCTGATTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029492.4-1215s21c1
Sequence:CCGGTTGATGAGTGCAAGGTATATACTCGAGTATATACCTTGCACTCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029492.4-189s21c1
Sequence:CCGGAGCTGTGCGTGAGTACTATTTCTCGAGAAATAGTACTCACGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029492
VALIDATED
ZDHHC20 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 20
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029492.3-174s1c1
Sequence:CCGGCCATCTGTTCTTTGTTATGTTCTCGAGAACATAACAAAGAACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029492.3-973s1c1
Sequence:CCGGAGTGACTACGTCAGAAGTATTCTCGAGAATACTTCTGACGTAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029492.3-625s1c1
Sequence:CCGGCCAAAGAATGAACCAACAGTTCTCGAGAACTGTTGGTTCATTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029492.3-152s1c1
Sequence:CCGGCCGTTGTTTACCTTGTGGCTTCTCGAGAAGCCACAAGGTAAACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029492.3-602s1c1
Sequence:CCGGGCAGGAAATCTACAGAGAATTCTCGAGAATTCTCTGTAGATTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029492.4-444s21c1
Sequence:CCGGCTTCAAAGGCTATCCGATATTCTCGAGAATATCGGATAGCCTTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029492.4-756s21c1
Sequence:CCGGTCAGTGTGCTCTCACTATTTACTCGAGTAAATAGTGAGAGCACACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029492.4-1141s21c1
Sequence:CCGGCACCAAATCAGGGACAAATAACTCGAGTTATTTGTCCCTGATTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029492.4-1215s21c1
Sequence:CCGGTTGATGAGTGCAAGGTATATACTCGAGTATATACCTTGCACTCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029492.4-189s21c1
Sequence:CCGGAGCTGTGCGTGAGTACTATTTCTCGAGAAATAGTACTCACGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks