EMAIL THIS PAGE TO A FRIEND

ZDHHC21

zinc finger, DHHC-type containing 21

Synonyms: 9130404H11Rik DHHC-21 DHHC21 DNZ1 HSPC097
UniProtKB ID: Q8IVQ6, A8KA95, D3DRI7, Q5VWG1
Gene ID:
Mouse(68268) zinc finger, DHHC domain containing 21
Rat(298184) zinc finger, DHHC-type containing 21
chicken(427356) zinc finger, DHHC-type containing 21
domestic cat(101095925) zinc finger, DHHC-type containing 21
dog(481546) zinc finger, DHHC-type containing 21
cow(535814) zinc finger, DHHC-type containing 21
domestic guinea pig(100723190) zinc finger, DHHC-type containing 21
naked mole-rat(101710011) zinc finger, DHHC-type containing 21
138 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302882 ANTI-ZDHHC21 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
flow cytometry, immunohistochemistry, western blot pricing
SAB2105989 Anti-ZDHHC21 antibody produced in rabbit affinity isolated antibody guinea pig, horse, human, rabbit
western blot pricing
HPA065254 Anti-ZDHHC21 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178566 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178566 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178566 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026647 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026647 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026647 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178566 Rosetta Predictions human pricing
NM_001039009 Rosetta Predictions rat pricing
NM_026647 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178566 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065916 predicted 663
2 SASI_Hs01_00065917 predicted 733
3 SASI_Hs01_00065918 predicted 656
4 SASI_Hs01_00065919 predicted 1111
5 SASI_Hs01_00065921 predicted 984
6 SASI_Hs01_00065922 predicted 755
7 SASI_Hs01_00065923 predicted 877
8 SASI_Hs01_00065924 predicted 908
9 SASI_Hs02_00369817 predicted 730
10 SASI_Hs02_00369818 predicted 745
11 SASI_Hs01_00065915 predicted 589
12 SASI_Hs01_00065920 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039009 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115223 predicted 256
2 SASI_Rn02_00204733 predicted 1060
3 SASI_Rn01_00115225 predicted 309
4 SASI_Rn01_00115226 predicted 798
5 SASI_Rn01_00115228 predicted 739
6 SASI_Rn01_00115229 predicted 197
7 SASI_Rn01_00115230 predicted 790
8 SASI_Rn01_00115231 predicted 608
9 SASI_Rn01_00115232 predicted 682
10 SASI_Rn02_00204734 predicted 380
11 SASI_Rn01_00115224 predicted 979
12 SASI_Rn01_00115227 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026647 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170703 predicted 765
2 SASI_Mm01_00170705 predicted 333
3 SASI_Mm01_00170706 predicted 780
4 SASI_Mm01_00170707 predicted 816
5 SASI_Mm01_00170708 predicted 1036
6 SASI_Mm02_00330643 predicted 790
7 SASI_Mm01_00170709 predicted 802
8 SASI_Mm01_00170711 predicted 1102
9 SASI_Mm01_00170712 predicted 920
10 SASI_Mm02_00330644 predicted 557
11 SASI_Mm01_00170704 predicted 278
12 SASI_Mm01_00170710 predicted 704
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178566
VALIDATED
ZDHHC21 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 21
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178566.3-1044s21c1
Sequence:CCGGGTTGGAATAACTGGACTCTTTCTCGAGAAAGAGTCCAGTTATTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178566.3-594s21c1
Sequence:CCGGGAAGGACATATTCCAGGCATACTCGAGTATGCCTGGAATATGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178566.3-1247s21c1
Sequence:CCGGCCACTTTGCCAATCATGTCTACTCGAGTAGACATGATTGGCAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_178566.3-723s21c1
Sequence:CCGGGAAAGGGAGTTCTGGGAATTACTCGAGTAATTCCCAGAACTCCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_178566.2-725s1c1
Sequence:CCGGGAAAGGGAGTTCTGGGAATTACTCGAGTAATTCCCAGAACTCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178566.2-596s1c1
Sequence:CCGGGAAGGACATATTCCAGGCATACTCGAGTATGCCTGGAATATGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178566.2-672s1c1
Sequence:CCGGCCTCCATAACTGATCCAGGAACTCGAGTTCCTGGATCAGTTATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_178566.2-1019s1c1
Sequence:CCGGGCAGCCTTTATGGGCATTACTCTCGAGAGTAATGCCCATAAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_178566.2-1046s1c1
Sequence:CCGGGTTGGAATAACTGGACTCTTTCTCGAGAAAGAGTCCAGTTATTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178566.2-1083s1c1
Sequence:CCGGGCATCATCACAGATACAACATCTCGAGATGTTGTATCTGTGATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178566
VALIDATED
ZDHHC21 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 21
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178566.3-1044s21c1
Sequence:CCGGGTTGGAATAACTGGACTCTTTCTCGAGAAAGAGTCCAGTTATTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178566.3-594s21c1
Sequence:CCGGGAAGGACATATTCCAGGCATACTCGAGTATGCCTGGAATATGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178566.3-1247s21c1
Sequence:CCGGCCACTTTGCCAATCATGTCTACTCGAGTAGACATGATTGGCAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_178566.3-723s21c1
Sequence:CCGGGAAAGGGAGTTCTGGGAATTACTCGAGTAATTCCCAGAACTCCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_178566.2-725s1c1
Sequence:CCGGGAAAGGGAGTTCTGGGAATTACTCGAGTAATTCCCAGAACTCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178566.2-596s1c1
Sequence:CCGGGAAGGACATATTCCAGGCATACTCGAGTATGCCTGGAATATGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178566.2-672s1c1
Sequence:CCGGCCTCCATAACTGATCCAGGAACTCGAGTTCCTGGATCAGTTATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_178566.2-1019s1c1
Sequence:CCGGGCAGCCTTTATGGGCATTACTCTCGAGAGTAATGCCCATAAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_178566.2-1046s1c1
Sequence:CCGGGTTGGAATAACTGGACTCTTTCTCGAGAAAGAGTCCAGTTATTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178566.2-1083s1c1
Sequence:CCGGGCATCATCACAGATACAACATCTCGAGATGTTGTATCTGTGATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178566
VALIDATED
ZDHHC21 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 21
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178566.3-1044s21c1
Sequence:CCGGGTTGGAATAACTGGACTCTTTCTCGAGAAAGAGTCCAGTTATTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178566.3-594s21c1
Sequence:CCGGGAAGGACATATTCCAGGCATACTCGAGTATGCCTGGAATATGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178566.3-1247s21c1
Sequence:CCGGCCACTTTGCCAATCATGTCTACTCGAGTAGACATGATTGGCAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_178566.3-723s21c1
Sequence:CCGGGAAAGGGAGTTCTGGGAATTACTCGAGTAATTCCCAGAACTCCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_178566.2-725s1c1
Sequence:CCGGGAAAGGGAGTTCTGGGAATTACTCGAGTAATTCCCAGAACTCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178566.2-596s1c1
Sequence:CCGGGAAGGACATATTCCAGGCATACTCGAGTATGCCTGGAATATGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178566.2-672s1c1
Sequence:CCGGCCTCCATAACTGATCCAGGAACTCGAGTTCCTGGATCAGTTATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_178566.2-1019s1c1
Sequence:CCGGGCAGCCTTTATGGGCATTACTCTCGAGAGTAATGCCCATAAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_178566.2-1046s1c1
Sequence:CCGGGTTGGAATAACTGGACTCTTTCTCGAGAAAGAGTCCAGTTATTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178566.2-1083s1c1
Sequence:CCGGGCATCATCACAGATACAACATCTCGAGATGTTGTATCTGTGATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026647
ZDHHC21 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 21
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026647.2-796s1c1
Sequence:CCGGACTCTTCTATACACAACTGATCTCGAGATCAGTTGTGTATAGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121377    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026647.2-1545s1c1
Sequence:CCGGCCCTTCTTTCTCCTTCTCAAACTCGAGTTTGAGAAGGAGAAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026647.2-769s1c1
Sequence:CCGGCATCACTATGTTAGTTGGAATCTCGAGATTCCAACTAACATAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026647.2-408s1c1
Sequence:CCGGCCTCCTTAACTGATCCTGGAACTCGAGTTCCAGGATCAGTTAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026647.2-640s1c1
Sequence:CCGGGCTTACTTGCTACGCACTGATCTCGAGATCAGTGCGTAGCAAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026647
ZDHHC21 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 21
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026647.2-796s1c1
Sequence:CCGGACTCTTCTATACACAACTGATCTCGAGATCAGTTGTGTATAGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121377    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026647.2-1545s1c1
Sequence:CCGGCCCTTCTTTCTCCTTCTCAAACTCGAGTTTGAGAAGGAGAAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026647.2-769s1c1
Sequence:CCGGCATCACTATGTTAGTTGGAATCTCGAGATTCCAACTAACATAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026647.2-408s1c1
Sequence:CCGGCCTCCTTAACTGATCCTGGAACTCGAGTTCCAGGATCAGTTAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026647.2-640s1c1
Sequence:CCGGGCTTACTTGCTACGCACTGATCTCGAGATCAGTGCGTAGCAAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026647
ZDHHC21 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 21
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026647.2-796s1c1
Sequence:CCGGACTCTTCTATACACAACTGATCTCGAGATCAGTTGTGTATAGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121377    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026647.2-1545s1c1
Sequence:CCGGCCCTTCTTTCTCCTTCTCAAACTCGAGTTTGAGAAGGAGAAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026647.2-769s1c1
Sequence:CCGGCATCACTATGTTAGTTGGAATCTCGAGATTCCAACTAACATAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026647.2-408s1c1
Sequence:CCGGCCTCCTTAACTGATCCTGGAACTCGAGTTCCAGGATCAGTTAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026647.2-640s1c1
Sequence:CCGGGCTTACTTGCTACGCACTGATCTCGAGATCAGTGCGTAGCAAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks