EMAIL THIS PAGE TO A FRIEND

ZDHHC22

zinc finger, DHHC-type containing 22

Synonyms: C14orf59
UniProtKB ID: Q8N966, A6NH02, B7Z2L5, Q149P4
Gene ID:
Mouse(238331) zinc finger, DHHC-type containing 22
Rat(299211) zinc finger, DHHC-type containing 22
naked mole-rat(101708586) zinc finger, DHHC-type containing 22
domestic guinea pig(100717381) zinc finger, DHHC-type containing 22
cow(613943) zinc finger, DHHC-type containing 22
sheep(101112985) zinc finger, DHHC-type containing 22
chicken(428895) zinc finger, DHHC-type containing 22
domestic cat(101100646) zinc finger, DHHC-type containing 22
dog(100686021) zinc finger, DHHC-type containing 22
98 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA072213 Anti-ZDHHC22 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174976 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174976 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174976 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001080943 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001080943 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001080943 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056731 MISSION® esiRNA esiRNA human ZDHHC22 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174976 Rosetta Predictions human pricing
NM_001039325 Rosetta Predictions rat pricing
NM_001080943 Rosetta Predictions mouse pricing
XM_138102 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174976 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117438 predicted 528
2 SASI_Hs02_00368919 predicted 1002
3 SASI_Hs02_00368920 predicted 1280
4 SASI_Hs01_00117441 predicted 974
5 SASI_Hs01_00117443 predicted 1436
6 SASI_Hs01_00117444 predicted 1081
7 SASI_Hs02_00368921 predicted 637
8 SASI_Hs02_00368922 predicted 723
9 SASI_Hs01_00117446 predicted 1027
10 SASI_Hs01_00117447 predicted 504
11 SASI_Hs01_00117439 predicted 1096
12 SASI_Hs01_00117440 predicted 1046
13 SASI_Hs01_00117442 predicted 579
14 SASI_Hs01_00117445 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039325 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105237 predicted 501
2 SASI_Rn02_00204809 predicted 343
3 SASI_Rn01_00105238 predicted 694
4 SASI_Rn01_00105239 predicted 411
5 SASI_Rn02_00204810 predicted 486
6 SASI_Rn01_00105240 predicted 295
7 SASI_Rn01_00105241 predicted 476
8 SASI_Rn02_00204811 predicted 717
9 SASI_Rn01_00105242 predicted 607
10 SASI_Rn01_00105243 predicted 355
11 SASI_Rn01_00105244 predicted 871
12 SASI_Rn01_00105245 predicted 573
13 SASI_Rn01_00105246 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080943 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294085 predicted 321
2 SASI_Mm02_00294086 predicted 244
3 SASI_Mm02_00294087 predicted 359
4 SASI_Mm02_00294088 predicted 493
5 SASI_Mm02_00294089 predicted 369
6 SASI_Mm02_00294090 predicted 300
7 SASI_Mm02_00294091 predicted 537
8 SASI_Mm02_00294092 predicted 337
9 SASI_Mm02_00294093 predicted 555
10 SASI_Mm02_00294094 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_138102 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204224 predicted 383
2 SASI_Mm01_00204225 predicted 299
3 SASI_Mm01_00204226 predicted 413
4 SASI_Mm01_00204227 predicted 557
5 SASI_Mm01_00204228 predicted 418
6 SASI_Mm01_00204229 predicted 361
7 SASI_Mm01_00204230 predicted 377
8 SASI_Mm01_00204231 predicted 600
9 SASI_Mm01_00204232 predicted 606
10 SASI_Mm01_00204233 predicted 560
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174976
ZDHHC22 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 22
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174976.1-392s1c1
Sequence:CCGGCAATTACGTCCTTGTCATCCACTCGAGTGGATGACAAGGACGTAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174976.1-2167s1c1
Sequence:CCGGCCAGAATATAAGGGTGCAATTCTCGAGAATTGCACCCTTATATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174976.1-612s1c1
Sequence:CCGGCAAGAACTTACAAGAGGTCTTCTCGAGAAGACCTCTTGTAAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174976.1-1528s1c1
Sequence:CCGGCGACTGTATAACCATATGGAACTCGAGTTCCATATGGTTATACAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183846    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174976.1-2515s1c1
Sequence:CCGGCGTATATTTATTGAGTGCCAACTCGAGTTGGCACTCAATAAATATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174976.1-609s1c1
Sequence:CCGGGCGCAAGAACTTACAAGAGGTCTCGAGACCTCTTGTAAGTTCTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174976.1-521s1c1
Sequence:CCGGGCACGACCATCACTGTTTCTTCTCGAGAAGAAACAGTGATGGTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174976.2-519s21c1
Sequence:CCGGAGGCACGACCATCACTGTTTCCTCGAGGAAACAGTGATGGTCGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174976.2-571s21c1
Sequence:CCGGTGCGCAACTTCGTCCTGTTCTCTCGAGAGAACAGGACGAAGTTGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418767    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174976.2-1031s21c1
Sequence:CCGGTTGACTCCTCCTGAGCATAAACTCGAGTTTATGCTCAGGAGGAGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174976.2-740s21c1
Sequence:CCGGGGGTTCTGAAATGTTCGTCATCTCGAGATGACGAACATTTCAGAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174976
ZDHHC22 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 22
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174976.1-392s1c1
Sequence:CCGGCAATTACGTCCTTGTCATCCACTCGAGTGGATGACAAGGACGTAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174976.1-2167s1c1
Sequence:CCGGCCAGAATATAAGGGTGCAATTCTCGAGAATTGCACCCTTATATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174976.1-612s1c1
Sequence:CCGGCAAGAACTTACAAGAGGTCTTCTCGAGAAGACCTCTTGTAAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174976.1-1528s1c1
Sequence:CCGGCGACTGTATAACCATATGGAACTCGAGTTCCATATGGTTATACAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183846    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174976.1-2515s1c1
Sequence:CCGGCGTATATTTATTGAGTGCCAACTCGAGTTGGCACTCAATAAATATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174976.1-609s1c1
Sequence:CCGGGCGCAAGAACTTACAAGAGGTCTCGAGACCTCTTGTAAGTTCTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174976.1-521s1c1
Sequence:CCGGGCACGACCATCACTGTTTCTTCTCGAGAAGAAACAGTGATGGTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174976.2-519s21c1
Sequence:CCGGAGGCACGACCATCACTGTTTCCTCGAGGAAACAGTGATGGTCGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174976.2-571s21c1
Sequence:CCGGTGCGCAACTTCGTCCTGTTCTCTCGAGAGAACAGGACGAAGTTGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418767    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174976.2-1031s21c1
Sequence:CCGGTTGACTCCTCCTGAGCATAAACTCGAGTTTATGCTCAGGAGGAGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174976.2-740s21c1
Sequence:CCGGGGGTTCTGAAATGTTCGTCATCTCGAGATGACGAACATTTCAGAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174976
ZDHHC22 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 22
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174976.1-392s1c1
Sequence:CCGGCAATTACGTCCTTGTCATCCACTCGAGTGGATGACAAGGACGTAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174976.1-2167s1c1
Sequence:CCGGCCAGAATATAAGGGTGCAATTCTCGAGAATTGCACCCTTATATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174976.1-612s1c1
Sequence:CCGGCAAGAACTTACAAGAGGTCTTCTCGAGAAGACCTCTTGTAAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174976.1-1528s1c1
Sequence:CCGGCGACTGTATAACCATATGGAACTCGAGTTCCATATGGTTATACAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183846    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174976.1-2515s1c1
Sequence:CCGGCGTATATTTATTGAGTGCCAACTCGAGTTGGCACTCAATAAATATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174976.1-609s1c1
Sequence:CCGGGCGCAAGAACTTACAAGAGGTCTCGAGACCTCTTGTAAGTTCTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174976.1-521s1c1
Sequence:CCGGGCACGACCATCACTGTTTCTTCTCGAGAAGAAACAGTGATGGTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174976.2-519s21c1
Sequence:CCGGAGGCACGACCATCACTGTTTCCTCGAGGAAACAGTGATGGTCGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174976.2-571s21c1
Sequence:CCGGTGCGCAACTTCGTCCTGTTCTCTCGAGAGAACAGGACGAAGTTGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418767    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174976.2-1031s21c1
Sequence:CCGGTTGACTCCTCCTGAGCATAAACTCGAGTTTATGCTCAGGAGGAGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174976.2-740s21c1
Sequence:CCGGGGGTTCTGAAATGTTCGTCATCTCGAGATGACGAACATTTCAGAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080943
ZDHHC22 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 22
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080943.2-35s21c1
Sequence:CCGGCCGCCTACTTTCTTTGCATTTCTCGAGAAATGCAAAGAAAGTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080943.2-174s21c1
Sequence:CCGGAGCCAATGCCCTGGGCAATTACTCGAGTAATTGCCCAGGGCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080943.2-489s21c1
Sequence:CCGGTACGCTCCTGCCCACTTCAATCTCGAGATTGAAGTGGGCAGGAGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080943.2-316s21c1
Sequence:CCGGAGGCACGACCATCACTGTTTCCTCGAGGAAACAGTGATGGTCGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080943.2-358s21c1
Sequence:CCGGAGCAGAAACATGCGCAACTTCCTCGAGGAAGTTGCGCATGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080943
ZDHHC22 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 22
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080943.2-35s21c1
Sequence:CCGGCCGCCTACTTTCTTTGCATTTCTCGAGAAATGCAAAGAAAGTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080943.2-174s21c1
Sequence:CCGGAGCCAATGCCCTGGGCAATTACTCGAGTAATTGCCCAGGGCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080943.2-489s21c1
Sequence:CCGGTACGCTCCTGCCCACTTCAATCTCGAGATTGAAGTGGGCAGGAGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080943.2-316s21c1
Sequence:CCGGAGGCACGACCATCACTGTTTCCTCGAGGAAACAGTGATGGTCGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080943.2-358s21c1
Sequence:CCGGAGCAGAAACATGCGCAACTTCCTCGAGGAAGTTGCGCATGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080943
ZDHHC22 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 22
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080943.2-35s21c1
Sequence:CCGGCCGCCTACTTTCTTTGCATTTCTCGAGAAATGCAAAGAAAGTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080943.2-174s21c1
Sequence:CCGGAGCCAATGCCCTGGGCAATTACTCGAGTAATTGCCCAGGGCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080943.2-489s21c1
Sequence:CCGGTACGCTCCTGCCCACTTCAATCTCGAGATTGAAGTGGGCAGGAGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080943.2-316s21c1
Sequence:CCGGAGGCACGACCATCACTGTTTCCTCGAGGAAACAGTGATGGTCGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080943.2-358s21c1
Sequence:CCGGAGCAGAAACATGCGCAACTTCCTCGAGGAAGTTGCGCATGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks