EMAIL THIS PAGE TO A FRIEND

ZDHHC23

zinc finger, DHHC-type containing 23

Synonyms: NIDD
UniProtKB ID: Q8IYP9, D3DN76
Gene ID:
Mouse(332175) zinc finger, DHHC domain containing 23
Rat(363783) zinc finger, DHHC-type containing 23
chicken(418353) zinc finger, DHHC-type containing 23
domestic cat(101097581) zinc finger, DHHC-type containing 23
dog(607759) zinc finger, DHHC-type containing 23
cow(512177) zinc finger, DHHC-type containing 23
sheep(101102277) zinc finger, DHHC-type containing 23
domestic guinea pig(100734156) zinc finger, DHHC-type containing 23
naked mole-rat(101716416) zinc finger, DHHC-type containing 23
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173570 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173570 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173570 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001007460 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001007460 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001007460 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU026691 MISSION® esiRNA esiRNA targeting mouse Zdhhc23 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173570 Rosetta Predictions human pricing
NM_213627 Rosetta Predictions rat pricing
NM_001007460 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224728 predicted 1423
2 SASI_Hs01_00224729 predicted 1156
3 SASI_Hs01_00224730 predicted 1394
4 SASI_Hs01_00224731 predicted 1572
5 SASI_Hs01_00224732 predicted 1283
6 SASI_Hs01_00224733 predicted 446
7 SASI_Hs01_00224734 predicted 696
8 SASI_Hs01_00224735 predicted 1316
9 SASI_Hs01_00224736 predicted 457
10 SASI_Hs01_00224737 predicted 1327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213627 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077655 predicted 1115
2 SASI_Rn02_00270618 predicted 1223
3 SASI_Rn01_00077656 predicted 1040
4 SASI_Rn01_00077657 predicted 618
5 SASI_Rn01_00077658 predicted 718
6 SASI_Rn01_00077659 predicted 1029
7 SASI_Rn01_00077660 predicted 1206
8 SASI_Rn01_00077661 predicted 992
9 SASI_Rn01_00077662 predicted 1189
10 SASI_Rn01_00077663 predicted 1046
11 SASI_Rn01_00077664 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007460 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102174 predicted 821
2 SASI_Mm01_00102176 predicted 580
3 SASI_Mm01_00102177 predicted 587
4 SASI_Mm01_00102178 predicted 903
5 SASI_Mm01_00102179 predicted 511
6 SASI_Mm01_00102180 predicted 657
7 SASI_Mm01_00102181 predicted 862
8 SASI_Mm01_00102182 predicted 440
9 SASI_Mm02_00286729 predicted 354
10 SASI_Mm01_00102183 predicted 934
11 SASI_Mm01_00102175 predicted 989
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173570
VALIDATED
ZDHHC23 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 23
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435701    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173570.3-1857s21c1
Sequence:CCGGGAGTTTATTGTGGAATCTTTGCTCGAGCAAAGATTCCACAATAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173570.3-1752s21c1
Sequence:CCGGGTAGGCTCTGTGACATCTTTGCTCGAGCAAAGATGTCACAGAGCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173570.3-456s21c1
Sequence:CCGGGATCGATGGATTACATGTAAACTCGAGTTTACATGTAATCCATCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173570.3-376s21c1
Sequence:CCGGGCGAGTACATAGATCGGAATGCTCGAGCATTCCGATCTATGTACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173570.1-1150s1c1
Sequence:CCGGGAATGGATCATCATTGTGTCTCTCGAGAGACACAATGATGATCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173570.1-1167s1c1
Sequence:CCGGGTCTGGATAAATAGCTGCGTTCTCGAGAACGCAGCTATTTATCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142795    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173570.1-1956s1c1
Sequence:CCGGCCTATAAATCAGCAGTCTCTTCTCGAGAAGAGACTGCTGATTTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173570.1-1415s1c1
Sequence:CCGGGCTGATCAACATCAGCTACAACTCGAGTTGTAGCTGATGTTGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_173570.1-485s1c1
Sequence:CCGGGCCAGAGACTTGTGAAAGAATCTCGAGATTCTTTCACAAGTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173570.1-1247s1c1
Sequence:CCGGGTATGGGATCACACTGACCTTCTCGAGAAGGTCAGTGTGATCCCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173570.1-1361s1c1
Sequence:CCGGCGTGTGGTACTCTGTGATCATCTCGAGATGATCACAGAGTACCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173570.1-514s1c1
Sequence:CCGGCAATTTCTGATCGCCTCCGAACTCGAGTTCGGAGGCGATCAGAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_173570.1-991s1c1
Sequence:CCGGGCAGTCTCAACAATCGCACAACTCGAGTTGTGCGATTGTTGAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173570.1-683s1c1
Sequence:CCGGCTACCTCACTAACAGAAGGAACTCGAGTTCCTTCTGTTAGTGAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173570
VALIDATED
ZDHHC23 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 23
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435701    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173570.3-1857s21c1
Sequence:CCGGGAGTTTATTGTGGAATCTTTGCTCGAGCAAAGATTCCACAATAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173570.3-1752s21c1
Sequence:CCGGGTAGGCTCTGTGACATCTTTGCTCGAGCAAAGATGTCACAGAGCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173570.3-456s21c1
Sequence:CCGGGATCGATGGATTACATGTAAACTCGAGTTTACATGTAATCCATCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173570.3-376s21c1
Sequence:CCGGGCGAGTACATAGATCGGAATGCTCGAGCATTCCGATCTATGTACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173570.1-1150s1c1
Sequence:CCGGGAATGGATCATCATTGTGTCTCTCGAGAGACACAATGATGATCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173570.1-1167s1c1
Sequence:CCGGGTCTGGATAAATAGCTGCGTTCTCGAGAACGCAGCTATTTATCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142795    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173570.1-1956s1c1
Sequence:CCGGCCTATAAATCAGCAGTCTCTTCTCGAGAAGAGACTGCTGATTTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173570.1-1415s1c1
Sequence:CCGGGCTGATCAACATCAGCTACAACTCGAGTTGTAGCTGATGTTGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_173570.1-485s1c1
Sequence:CCGGGCCAGAGACTTGTGAAAGAATCTCGAGATTCTTTCACAAGTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173570.1-1247s1c1
Sequence:CCGGGTATGGGATCACACTGACCTTCTCGAGAAGGTCAGTGTGATCCCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173570.1-1361s1c1
Sequence:CCGGCGTGTGGTACTCTGTGATCATCTCGAGATGATCACAGAGTACCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173570.1-514s1c1
Sequence:CCGGCAATTTCTGATCGCCTCCGAACTCGAGTTCGGAGGCGATCAGAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_173570.1-991s1c1
Sequence:CCGGGCAGTCTCAACAATCGCACAACTCGAGTTGTGCGATTGTTGAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173570.1-683s1c1
Sequence:CCGGCTACCTCACTAACAGAAGGAACTCGAGTTCCTTCTGTTAGTGAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173570
VALIDATED
ZDHHC23 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 23
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435701    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173570.3-1857s21c1
Sequence:CCGGGAGTTTATTGTGGAATCTTTGCTCGAGCAAAGATTCCACAATAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173570.3-1752s21c1
Sequence:CCGGGTAGGCTCTGTGACATCTTTGCTCGAGCAAAGATGTCACAGAGCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173570.3-456s21c1
Sequence:CCGGGATCGATGGATTACATGTAAACTCGAGTTTACATGTAATCCATCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173570.3-376s21c1
Sequence:CCGGGCGAGTACATAGATCGGAATGCTCGAGCATTCCGATCTATGTACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173570.1-1150s1c1
Sequence:CCGGGAATGGATCATCATTGTGTCTCTCGAGAGACACAATGATGATCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173570.1-1167s1c1
Sequence:CCGGGTCTGGATAAATAGCTGCGTTCTCGAGAACGCAGCTATTTATCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142795    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173570.1-1956s1c1
Sequence:CCGGCCTATAAATCAGCAGTCTCTTCTCGAGAAGAGACTGCTGATTTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173570.1-1415s1c1
Sequence:CCGGGCTGATCAACATCAGCTACAACTCGAGTTGTAGCTGATGTTGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_173570.1-485s1c1
Sequence:CCGGGCCAGAGACTTGTGAAAGAATCTCGAGATTCTTTCACAAGTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173570.1-1247s1c1
Sequence:CCGGGTATGGGATCACACTGACCTTCTCGAGAAGGTCAGTGTGATCCCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173570.1-1361s1c1
Sequence:CCGGCGTGTGGTACTCTGTGATCATCTCGAGATGATCACAGAGTACCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173570.1-514s1c1
Sequence:CCGGCAATTTCTGATCGCCTCCGAACTCGAGTTCGGAGGCGATCAGAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_173570.1-991s1c1
Sequence:CCGGGCAGTCTCAACAATCGCACAACTCGAGTTGTGCGATTGTTGAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173570.1-683s1c1
Sequence:CCGGCTACCTCACTAACAGAAGGAACTCGAGTTCCTTCTGTTAGTGAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007460
ZDHHC23 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 23
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007460.1-348s1c1
Sequence:CCGGGCTGGCACTCTGGTATTACTACTCGAGTAGTAATACCAGAGTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007460.1-48s1c1
Sequence:CCGGCCTGTGCTGTTGCGAATACATCTCGAGATGTATTCGCAACAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007460.1-594s1c1
Sequence:CCGGCCAAATTGAATGCCCGGTCAACTCGAGTTGACCGGGCATTCAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007460.1-1086s1c1
Sequence:CCGGGCTGATAAACATCAGCTACAACTCGAGTTGTAGCTGATGTTTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007460.1-519s1c1
Sequence:CCGGTCTGATACTCTTAGCCTTGTACTCGAGTACAAGGCTAAGAGTATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007460
ZDHHC23 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 23
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007460.1-348s1c1
Sequence:CCGGGCTGGCACTCTGGTATTACTACTCGAGTAGTAATACCAGAGTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007460.1-48s1c1
Sequence:CCGGCCTGTGCTGTTGCGAATACATCTCGAGATGTATTCGCAACAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007460.1-594s1c1
Sequence:CCGGCCAAATTGAATGCCCGGTCAACTCGAGTTGACCGGGCATTCAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007460.1-1086s1c1
Sequence:CCGGGCTGATAAACATCAGCTACAACTCGAGTTGTAGCTGATGTTTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007460.1-519s1c1
Sequence:CCGGTCTGATACTCTTAGCCTTGTACTCGAGTACAAGGCTAAGAGTATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007460
ZDHHC23 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 23
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007460.1-348s1c1
Sequence:CCGGGCTGGCACTCTGGTATTACTACTCGAGTAGTAATACCAGAGTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007460.1-48s1c1
Sequence:CCGGCCTGTGCTGTTGCGAATACATCTCGAGATGTATTCGCAACAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007460.1-594s1c1
Sequence:CCGGCCAAATTGAATGCCCGGTCAACTCGAGTTGACCGGGCATTCAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007460.1-1086s1c1
Sequence:CCGGGCTGATAAACATCAGCTACAACTCGAGTTGTAGCTGATGTTTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007460.1-519s1c1
Sequence:CCGGTCTGATACTCTTAGCCTTGTACTCGAGTACAAGGCTAAGAGTATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks