EMAIL THIS PAGE TO A FRIEND

ZDHHC24

zinc finger, DHHC-type containing 24

UniProtKB ID: Q6UX98, Q6PEW7, Q9BSJ0
Gene ID:
Mouse(70605) zinc finger, DHHC domain containing 24
Rat(293665) zinc finger, DHHC-type containing 24
Zebrafish(436596) zinc finger, DHHC-type containing 24
dog(483708) zinc finger, DHHC-type containing 24
domestic cat(101086752) zinc finger, DHHC-type containing 24
naked mole-rat(101720310) zinc finger, DHHC-type containing 24
domestic guinea pig(100729625) zinc finger, DHHC-type containing 24
cow(530442) zinc finger, DHHC-type containing 24
sheep(101116186) zinc finger, DHHC-type containing 24
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027476 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027476 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027476 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_207340 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207340 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207340 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207340 Rosetta Predictions human pricing
NM_001039100 Rosetta Predictions rat pricing
NM_027476 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183030 predicted 1000
2 SASI_Hs01_00183032 predicted 764
3 SASI_Hs01_00183033 predicted 399
4 SASI_Hs01_00183034 predicted 468
5 SASI_Hs01_00183035 predicted 247
6 SASI_Hs01_00183036 predicted 1000
7 SASI_Hs01_00183037 predicted 837
8 SASI_Hs01_00183038 predicted 708
9 SASI_Hs02_00373894 predicted 1002
10 SASI_Hs01_00183039 predicted 588
11 SASI_Hs01_00183031 predicted 1018
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039100 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105614 predicted 590
2 SASI_Rn01_00105615 predicted 406
3 SASI_Rn01_00105617 predicted 772
4 SASI_Rn01_00105618 predicted 860
5 SASI_Rn01_00105619 predicted 1038
6 SASI_Rn02_00204796 predicted 816
7 SASI_Rn01_00105620 predicted 1143
8 SASI_Rn02_00204797 predicted 815
9 SASI_Rn02_00204798 predicted 556
10 SASI_Rn01_00105621 predicted 779
11 SASI_Rn01_00105613 predicted 1079
12 SASI_Rn01_00105616 predicted 1299
13 SASI_Rn01_00105622 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027476 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059776 predicted 382
2 SASI_Mm01_00059777 predicted 1031
3 SASI_Mm01_00059778 predicted 1390
4 SASI_Mm01_00059779 predicted 797
5 SASI_Mm01_00059780 predicted 996
6 SASI_Mm01_00059781 predicted 582
7 SASI_Mm02_00332290 predicted 480
8 SASI_Mm01_00059782 predicted 1332
9 SASI_Mm01_00059784 predicted 348
10 SASI_Mm01_00059785 predicted 887
11 SASI_Mm01_00059783 predicted 844
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027476
ZDHHC24 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 24
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027476.1-1474s1c1
Sequence:CCGGCTGGTAGAAATGTAGACCTTACTCGAGTAAGGTCTACATTTCTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027476.1-1166s1c1
Sequence:CCGGCCATCTTTGCTGGGTTCCTATCTCGAGATAGGAACCCAGCAAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027476.1-1473s1c1
Sequence:CCGGGCTGGTAGAAATGTAGACCTTCTCGAGAAGGTCTACATTTCTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193736    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027476.1-1182s1c1
Sequence:CCGGCCTATACCTCACTTTGTTGTTCTCGAGAACAACAAAGTGAGGTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027476.3-886s21c1
Sequence:CCGGGATGGGATCTCTTTCCAGACTCTCGAGAGTCTGGAAAGAGATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027476.3-1057s21c1
Sequence:CCGGCCTTCTTTGAACCTGCCCAATCTCGAGATTGGGCAGGTTCAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027476.3-467s21c1
Sequence:CCGGGCTGTGTGGGCTTCCATAATTCTCGAGAATTATGGAAGCCCACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027476.3-911s21c1
Sequence:CCGGGTGATGTGGGTCTTGTGACTTCTCGAGAAGTCACAAGACCCACATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027476.3-627s21c1
Sequence:CCGGCATGCTACTCACAGGCAAAGTCTCGAGACTTTGCCTGTGAGTAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027476.3-1362s21c1
Sequence:CCGGCCAGACGTGCTCTAGAGATTACTCGAGTAATCTCTAGAGCACGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027476
ZDHHC24 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 24
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027476.1-1474s1c1
Sequence:CCGGCTGGTAGAAATGTAGACCTTACTCGAGTAAGGTCTACATTTCTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027476.1-1166s1c1
Sequence:CCGGCCATCTTTGCTGGGTTCCTATCTCGAGATAGGAACCCAGCAAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027476.1-1473s1c1
Sequence:CCGGGCTGGTAGAAATGTAGACCTTCTCGAGAAGGTCTACATTTCTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193736    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027476.1-1182s1c1
Sequence:CCGGCCTATACCTCACTTTGTTGTTCTCGAGAACAACAAAGTGAGGTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027476.3-886s21c1
Sequence:CCGGGATGGGATCTCTTTCCAGACTCTCGAGAGTCTGGAAAGAGATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027476.3-1057s21c1
Sequence:CCGGCCTTCTTTGAACCTGCCCAATCTCGAGATTGGGCAGGTTCAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027476.3-467s21c1
Sequence:CCGGGCTGTGTGGGCTTCCATAATTCTCGAGAATTATGGAAGCCCACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027476.3-911s21c1
Sequence:CCGGGTGATGTGGGTCTTGTGACTTCTCGAGAAGTCACAAGACCCACATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027476.3-627s21c1
Sequence:CCGGCATGCTACTCACAGGCAAAGTCTCGAGACTTTGCCTGTGAGTAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027476.3-1362s21c1
Sequence:CCGGCCAGACGTGCTCTAGAGATTACTCGAGTAATCTCTAGAGCACGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027476
ZDHHC24 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 24
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027476.1-1474s1c1
Sequence:CCGGCTGGTAGAAATGTAGACCTTACTCGAGTAAGGTCTACATTTCTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027476.1-1166s1c1
Sequence:CCGGCCATCTTTGCTGGGTTCCTATCTCGAGATAGGAACCCAGCAAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027476.1-1473s1c1
Sequence:CCGGGCTGGTAGAAATGTAGACCTTCTCGAGAAGGTCTACATTTCTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193736    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027476.1-1182s1c1
Sequence:CCGGCCTATACCTCACTTTGTTGTTCTCGAGAACAACAAAGTGAGGTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027476.3-886s21c1
Sequence:CCGGGATGGGATCTCTTTCCAGACTCTCGAGAGTCTGGAAAGAGATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027476.3-1057s21c1
Sequence:CCGGCCTTCTTTGAACCTGCCCAATCTCGAGATTGGGCAGGTTCAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027476.3-467s21c1
Sequence:CCGGGCTGTGTGGGCTTCCATAATTCTCGAGAATTATGGAAGCCCACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027476.3-911s21c1
Sequence:CCGGGTGATGTGGGTCTTGTGACTTCTCGAGAAGTCACAAGACCCACATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027476.3-627s21c1
Sequence:CCGGCATGCTACTCACAGGCAAAGTCTCGAGACTTTGCCTGTGAGTAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027476.3-1362s21c1
Sequence:CCGGCCAGACGTGCTCTAGAGATTACTCGAGTAATCTCTAGAGCACGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207340
ZDHHC24 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 24
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000245984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207340.1-1014s21c1
Sequence:CCGGTTCCAGACCACAGCAGATGTGCTCGAGCACATCTGCTGTGGTCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207340.1-1124s21c1
Sequence:CCGGGAAGTCGGGTTGGACCTTAACCTCGAGGTTAAGGTCCAACCCGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207340.1-473s21c1
Sequence:CCGGCTGGGCTTACTGCTACCAATGCTCGAGCATTGGTAGCAGTAAGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207340.1-744s21c1
Sequence:CCGGATGTTGCTCACAGGCAGAGTGCTCGAGCACTCTGCCTGTGAGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207340
ZDHHC24 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 24
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000245984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207340.1-1014s21c1
Sequence:CCGGTTCCAGACCACAGCAGATGTGCTCGAGCACATCTGCTGTGGTCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207340.1-1124s21c1
Sequence:CCGGGAAGTCGGGTTGGACCTTAACCTCGAGGTTAAGGTCCAACCCGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207340.1-473s21c1
Sequence:CCGGCTGGGCTTACTGCTACCAATGCTCGAGCATTGGTAGCAGTAAGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207340.1-744s21c1
Sequence:CCGGATGTTGCTCACAGGCAGAGTGCTCGAGCACTCTGCCTGTGAGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207340
ZDHHC24 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 24
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000245984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207340.1-1014s21c1
Sequence:CCGGTTCCAGACCACAGCAGATGTGCTCGAGCACATCTGCTGTGGTCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207340.1-1124s21c1
Sequence:CCGGGAAGTCGGGTTGGACCTTAACCTCGAGGTTAAGGTCCAACCCGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207340.1-473s21c1
Sequence:CCGGCTGGGCTTACTGCTACCAATGCTCGAGCATTGGTAGCAGTAAGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207340.1-744s21c1
Sequence:CCGGATGTTGCTCACAGGCAGAGTGCTCGAGCACTCTGCCTGTGAGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks