EMAIL THIS PAGE TO A FRIEND

ZDHHC2

zinc finger, DHHC-type containing 2

Synonyms: DHHC2 ZNF372
UniProtKB ID: Q9UIJ5, D3DSP5
Gene ID:
Mouse(70546) zinc finger, DHHC domain containing 2
Rat(246326) zinc finger, DHHC-type containing 2
cow(536310) zinc finger, DHHC-type containing 2
sheep(101111341) zinc finger, DHHC-type containing 2
domestic guinea pig(100733409) zinc finger, DHHC-type containing 2
naked mole-rat(101701021) zinc finger, DHHC-type containing 2
Zebrafish(541365) zinc finger, DHHC-type containing 2
dog(475610) zinc finger, DHHC-type containing 2
domestic cat(101081038) zinc finger, DHHC-type containing 2
chicken(422734) zinc finger, DHHC-type containing 2
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016353 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016353 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016353 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178395 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178395 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178395 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016353 Rosetta Predictions human pricing
NM_145096 Rosetta Predictions rat pricing
NM_178395 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349315 predicted 793
2 SASI_Hs01_00048260 predicted 1401
3 SASI_Hs01_00048261 predicted 815
4 SASI_Hs02_00349316 predicted 658
5 SASI_Hs01_00048263 predicted 539
6 SASI_Hs01_00048265 predicted 1308
7 SASI_Hs01_00048266 predicted 933
8 SASI_Hs01_00048267 predicted 458
9 SASI_Hs01_00048268 predicted 1127
10 SASI_Hs01_00048269 predicted 533
11 SASI_Hs01_00048262 predicted 592
12 SASI_Hs01_00048264 predicted 1302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042482 predicted 1145
2 SASI_Rn01_00042483 predicted 1042
3 SASI_Rn01_00042484 predicted 1383
4 SASI_Rn01_00042485 predicted 552
5 SASI_Rn01_00042486 predicted 555
6 SASI_Rn01_00042487 predicted 1294
7 SASI_Rn01_00042488 predicted 949
8 SASI_Rn01_00042489 predicted 1177
9 SASI_Rn01_00042490 predicted 1277
10 SASI_Rn02_00268693 predicted 1188
11 SASI_Rn01_00042491 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178395 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043919 predicted 1307
2 SASI_Mm01_00043921 predicted 1025
3 SASI_Mm02_00348804 predicted 1027
4 SASI_Mm02_00348805 predicted 535
5 SASI_Mm01_00043922 predicted 1410
6 SASI_Mm01_00043923 predicted 809
7 SASI_Mm01_00043924 predicted 978
8 SASI_Mm01_00043925 predicted 377
9 SASI_Mm01_00043926 predicted 1150
10 SASI_Mm01_00043927 predicted 964
11 SASI_Mm01_00043918 predicted 1187
12 SASI_Mm01_00043920 predicted 560
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016353
VALIDATED
ZDHHC2 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016353.2-973s1c1
Sequence:CCGGGAATGGATTCAGCTTGGGTTTCTCGAGAAACCCAAGCTGAATCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139146    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016353.2-1823s1c1
Sequence:CCGGCCTCAGACTGAGTGAACTGTACTCGAGTACAGTTCACTCAGTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016353.2-352s1c1
Sequence:CCGGCGAACAAGTTGTGTGCCTGATCTCGAGATCAGGCACACAACTTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016353.2-1905s1c1
Sequence:CCGGGCCTCACTTAATTCCAGCCTTCTCGAGAAGGCTGGAATTAAGTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016353.2-536s1c1
Sequence:CCGGGCCAAGGATCTTCCCATCTATCTCGAGATAGATGGGAAGATCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016353.2-630s1c1
Sequence:CCGGGCTCCGTCTGTGATAAATGTACTCGAGTACATTTATCACAGACGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016353.2-1266s1c1
Sequence:CCGGGTATGAGCAATCCTGCATTAACTCGAGTTAATGCAGGATTGCTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016353.2-1078s1c1
Sequence:CCGGCTTTCCAACTTGCCTTGTTAACTCGAGTTAACAAGGCAAGTTGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016353.2-956s1c1
Sequence:CCGGCGACATGGAACAGATAAGAATCTCGAGATTCTTATCTGTTCCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016353.2-458s1c1
Sequence:CCGGCATCTCTCTTATGCAGAGAAACTCGAGTTTCTCTGCATAAGAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016353
VALIDATED
ZDHHC2 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016353.2-973s1c1
Sequence:CCGGGAATGGATTCAGCTTGGGTTTCTCGAGAAACCCAAGCTGAATCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139146    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016353.2-1823s1c1
Sequence:CCGGCCTCAGACTGAGTGAACTGTACTCGAGTACAGTTCACTCAGTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016353.2-352s1c1
Sequence:CCGGCGAACAAGTTGTGTGCCTGATCTCGAGATCAGGCACACAACTTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016353.2-1905s1c1
Sequence:CCGGGCCTCACTTAATTCCAGCCTTCTCGAGAAGGCTGGAATTAAGTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016353.2-536s1c1
Sequence:CCGGGCCAAGGATCTTCCCATCTATCTCGAGATAGATGGGAAGATCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016353.2-630s1c1
Sequence:CCGGGCTCCGTCTGTGATAAATGTACTCGAGTACATTTATCACAGACGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016353.2-1266s1c1
Sequence:CCGGGTATGAGCAATCCTGCATTAACTCGAGTTAATGCAGGATTGCTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016353.2-1078s1c1
Sequence:CCGGCTTTCCAACTTGCCTTGTTAACTCGAGTTAACAAGGCAAGTTGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016353.2-956s1c1
Sequence:CCGGCGACATGGAACAGATAAGAATCTCGAGATTCTTATCTGTTCCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016353.2-458s1c1
Sequence:CCGGCATCTCTCTTATGCAGAGAAACTCGAGTTTCTCTGCATAAGAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016353
VALIDATED
ZDHHC2 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016353.2-973s1c1
Sequence:CCGGGAATGGATTCAGCTTGGGTTTCTCGAGAAACCCAAGCTGAATCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139146    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016353.2-1823s1c1
Sequence:CCGGCCTCAGACTGAGTGAACTGTACTCGAGTACAGTTCACTCAGTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016353.2-352s1c1
Sequence:CCGGCGAACAAGTTGTGTGCCTGATCTCGAGATCAGGCACACAACTTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016353.2-1905s1c1
Sequence:CCGGGCCTCACTTAATTCCAGCCTTCTCGAGAAGGCTGGAATTAAGTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016353.2-536s1c1
Sequence:CCGGGCCAAGGATCTTCCCATCTATCTCGAGATAGATGGGAAGATCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016353.2-630s1c1
Sequence:CCGGGCTCCGTCTGTGATAAATGTACTCGAGTACATTTATCACAGACGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016353.2-1266s1c1
Sequence:CCGGGTATGAGCAATCCTGCATTAACTCGAGTTAATGCAGGATTGCTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016353.2-1078s1c1
Sequence:CCGGCTTTCCAACTTGCCTTGTTAACTCGAGTTAACAAGGCAAGTTGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016353.2-956s1c1
Sequence:CCGGCGACATGGAACAGATAAGAATCTCGAGATTCTTATCTGTTCCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016353.2-458s1c1
Sequence:CCGGCATCTCTCTTATGCAGAGAAACTCGAGTTTCTCTGCATAAGAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178395
VALIDATED
ZDHHC2 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178395.2-959s1c1
Sequence:CCGGGCATTCAGAAATCCAGTATTTCTCGAGAAATACTGGATTTCTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178395.2-1101s1c1
Sequence:CCGGCCTTTCCAACTTGCCTTGTTACTCGAGTAACAAGGCAAGTTGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178395.2-1300s1c1
Sequence:CCGGCCCTGCATTAACTATGGAGAACTCGAGTTCTCCATAGTTAATGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178395.2-1850s1c1
Sequence:CCGGGCATTGACTATGAACTCATTACTCGAGTAATGAGTTCATAGTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178395.2-985s1c1
Sequence:CCGGCGGAACAGATAAGAACGGATTCTCGAGAATCCGTTCTTATCTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178395
VALIDATED
ZDHHC2 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178395.2-959s1c1
Sequence:CCGGGCATTCAGAAATCCAGTATTTCTCGAGAAATACTGGATTTCTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178395.2-1101s1c1
Sequence:CCGGCCTTTCCAACTTGCCTTGTTACTCGAGTAACAAGGCAAGTTGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178395.2-1300s1c1
Sequence:CCGGCCCTGCATTAACTATGGAGAACTCGAGTTCTCCATAGTTAATGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178395.2-1850s1c1
Sequence:CCGGGCATTGACTATGAACTCATTACTCGAGTAATGAGTTCATAGTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178395.2-985s1c1
Sequence:CCGGCGGAACAGATAAGAACGGATTCTCGAGAATCCGTTCTTATCTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178395
VALIDATED
ZDHHC2 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178395.2-959s1c1
Sequence:CCGGGCATTCAGAAATCCAGTATTTCTCGAGAAATACTGGATTTCTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178395.2-1101s1c1
Sequence:CCGGCCTTTCCAACTTGCCTTGTTACTCGAGTAACAAGGCAAGTTGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178395.2-1300s1c1
Sequence:CCGGCCCTGCATTAACTATGGAGAACTCGAGTTCTCCATAGTTAATGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178395.2-1850s1c1
Sequence:CCGGGCATTGACTATGAACTCATTACTCGAGTAATGAGTTCATAGTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178395.2-985s1c1
Sequence:CCGGCGGAACAGATAAGAACGGATTCTCGAGAATCCGTTCTTATCTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks