EMAIL THIS PAGE TO A FRIEND

ZDHHC3

zinc finger, DHHC-type containing 3

Synonyms: DHHC-3 GODZ ZNF373
UniProtKB ID: Q9NYG2, Q53A17, Q96BL0
Gene ID:
Mouse(69035) zinc finger, DHHC domain containing 3
Rat(301081) zinc finger, DHHC-type containing 3
domestic guinea pig(100713409) zinc finger, DHHC-type containing 3
naked mole-rat(101701745) zinc finger, DHHC-type containing 3
cow(506728) zinc finger, DHHC-type containing 3
sheep(101120529) zinc finger, DHHC-type containing 3
Zebrafish(436998) zinc finger, DHHC-type containing 3
chicken(420705) zinc finger, DHHC-type containing 3
dog(476655) zinc finger, DHHC-type containing 3
domestic cat(101081449) zinc finger, DHHC-type containing 3
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016598 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016598 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016598 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026917 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026917 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026917 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016598 Rosetta Predictions human pricing
NM_001039014 Rosetta Predictions rat pricing
NM_026917 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016598 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133395 predicted 853
2 SASI_Hs01_00133396 predicted 1654
3 SASI_Hs01_00133397 predicted 251
4 SASI_Hs01_00133398 predicted 707
5 SASI_Hs02_00349727 predicted 788
6 SASI_Hs01_00133399 predicted 301
7 SASI_Hs01_00133400 predicted 717
8 SASI_Hs01_00133401 predicted 712
9 SASI_Hs01_00133402 predicted 1682
10 SASI_Hs01_00133403 predicted 1017
11 SASI_Hs01_00133394 predicted 934
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039014 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084374 predicted 405
2 SASI_Rn01_00084375 predicted 517
3 SASI_Rn01_00084376 predicted 539
4 SASI_Rn01_00084377 predicted 349
5 SASI_Rn02_00204744 predicted 200
6 SASI_Rn01_00084378 predicted 232
7 SASI_Rn01_00084379 predicted 525
8 SASI_Rn01_00084380 predicted 229
9 SASI_Rn01_00084381 predicted 747
10 SASI_Rn01_00084382 predicted 612
11 SASI_Rn01_00084373 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026917 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331193 predicted 1440
2 SASI_Mm01_00142327 predicted 929
3 SASI_Mm02_00331194 predicted 873
4 SASI_Mm01_00142329 predicted 348
5 SASI_Mm01_00142331 predicted 642
6 SASI_Mm01_00142332 predicted 310
7 SASI_Mm01_00142333 predicted 467
8 SASI_Mm01_00142334 predicted 234
9 SASI_Mm01_00142335 predicted 626
10 SASI_Mm01_00142336 predicted 850
11 SASI_Mm01_00142328 predicted 528
12 SASI_Mm01_00142330 predicted 640
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016598
VALIDATED
ZDHHC3 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164496    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_016598.1-1758s1c1
Sequence:CCGGCCTGCTAACTCGCAAAGCAATCTCGAGATTGCTTTGCGAGTTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016598.1-556s1c1
Sequence:CCGGCATCGAGAGTTTACAGTTGAACTCGAGTTCAACTGTAAACTCTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159710    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016598.1-1839s1c1
Sequence:CCGGGAAAGATGAAAGAGGTCTTATCTCGAGATAAGACCTCTTTCATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016598.1-804s1c1
Sequence:CCGGGCTTTGAAGAAGATTGGACAACTCGAGTTGTCCAATCTTCTTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016598.1-854s1c1
Sequence:CCGGGAGACTGGAATCTCTCTTCATCTCGAGATGAAGAGAGATTCCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161843    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016598.1-2342s1c1
Sequence:CCGGGCACTGGGACAGAATAGATTTCTCGAGAAATCTATTCTGTCCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162097    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_016598.1-2381s1c1
Sequence:CCGGCCTGTGTCAGTCTTGTTTGAACTCGAGTTCAAACAAGACTGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016598.1-718s1c1
Sequence:CCGGCCAGAAGTACTTCGTCCTGTTCTCGAGAACAGGACGAAGTACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016598.1-1090s1c1
Sequence:CCGGGTGGATGAACATGAAAGCCGTCTCGAGACGGCTTTCATGTTCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016598.1-530s1c1
Sequence:CCGGCCCAAAGGAAATGCCACTAAACTCGAGTTTAGTGGCATTTCCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016598.1-242s1c1
Sequence:CCGGCGAAACATTGAGCGGAAACCACTCGAGTGGTTTCCGCTCAATGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016598.1-809s1c1
Sequence:CCGGGAAGAAGATTGGACAACCTATCTCGAGATAGGTTGTCCAATCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016598.1-436s1c1
Sequence:CCGGGTATAGCATCATCAACGGAATCTCGAGATTCCGTTGATGATGCTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016598
VALIDATED
ZDHHC3 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164496    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_016598.1-1758s1c1
Sequence:CCGGCCTGCTAACTCGCAAAGCAATCTCGAGATTGCTTTGCGAGTTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016598.1-556s1c1
Sequence:CCGGCATCGAGAGTTTACAGTTGAACTCGAGTTCAACTGTAAACTCTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159710    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016598.1-1839s1c1
Sequence:CCGGGAAAGATGAAAGAGGTCTTATCTCGAGATAAGACCTCTTTCATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016598.1-804s1c1
Sequence:CCGGGCTTTGAAGAAGATTGGACAACTCGAGTTGTCCAATCTTCTTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016598.1-854s1c1
Sequence:CCGGGAGACTGGAATCTCTCTTCATCTCGAGATGAAGAGAGATTCCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161843    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016598.1-2342s1c1
Sequence:CCGGGCACTGGGACAGAATAGATTTCTCGAGAAATCTATTCTGTCCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162097    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_016598.1-2381s1c1
Sequence:CCGGCCTGTGTCAGTCTTGTTTGAACTCGAGTTCAAACAAGACTGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016598.1-718s1c1
Sequence:CCGGCCAGAAGTACTTCGTCCTGTTCTCGAGAACAGGACGAAGTACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016598.1-1090s1c1
Sequence:CCGGGTGGATGAACATGAAAGCCGTCTCGAGACGGCTTTCATGTTCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016598.1-530s1c1
Sequence:CCGGCCCAAAGGAAATGCCACTAAACTCGAGTTTAGTGGCATTTCCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016598.1-242s1c1
Sequence:CCGGCGAAACATTGAGCGGAAACCACTCGAGTGGTTTCCGCTCAATGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016598.1-809s1c1
Sequence:CCGGGAAGAAGATTGGACAACCTATCTCGAGATAGGTTGTCCAATCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016598.1-436s1c1
Sequence:CCGGGTATAGCATCATCAACGGAATCTCGAGATTCCGTTGATGATGCTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016598
VALIDATED
ZDHHC3 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164496    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_016598.1-1758s1c1
Sequence:CCGGCCTGCTAACTCGCAAAGCAATCTCGAGATTGCTTTGCGAGTTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016598.1-556s1c1
Sequence:CCGGCATCGAGAGTTTACAGTTGAACTCGAGTTCAACTGTAAACTCTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159710    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016598.1-1839s1c1
Sequence:CCGGGAAAGATGAAAGAGGTCTTATCTCGAGATAAGACCTCTTTCATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016598.1-804s1c1
Sequence:CCGGGCTTTGAAGAAGATTGGACAACTCGAGTTGTCCAATCTTCTTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016598.1-854s1c1
Sequence:CCGGGAGACTGGAATCTCTCTTCATCTCGAGATGAAGAGAGATTCCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161843    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016598.1-2342s1c1
Sequence:CCGGGCACTGGGACAGAATAGATTTCTCGAGAAATCTATTCTGTCCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162097    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_016598.1-2381s1c1
Sequence:CCGGCCTGTGTCAGTCTTGTTTGAACTCGAGTTCAAACAAGACTGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016598.1-718s1c1
Sequence:CCGGCCAGAAGTACTTCGTCCTGTTCTCGAGAACAGGACGAAGTACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016598.1-1090s1c1
Sequence:CCGGGTGGATGAACATGAAAGCCGTCTCGAGACGGCTTTCATGTTCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016598.1-530s1c1
Sequence:CCGGCCCAAAGGAAATGCCACTAAACTCGAGTTTAGTGGCATTTCCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016598.1-242s1c1
Sequence:CCGGCGAAACATTGAGCGGAAACCACTCGAGTGGTTTCCGCTCAATGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016598.1-809s1c1
Sequence:CCGGGAAGAAGATTGGACAACCTATCTCGAGATAGGTTGTCCAATCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016598.1-436s1c1
Sequence:CCGGGTATAGCATCATCAACGGAATCTCGAGATTCCGTTGATGATGCTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026917
VALIDATED
ZDHHC3 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026917.4-1779s1c1
Sequence:CCGGCCCAGCAAGATGTCAGTCATTCTCGAGAATGACTGACATCTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026917.4-729s1c1
Sequence:CCGGGCTTTGAAGAAGACTGGACAACTCGAGTTGTCCAGTCTTCTTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026917.4-242s1c1
Sequence:CCGGGCCATGTGGTTTATCCGAGATCTCGAGATCTCGGATAAACCACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026917.4-311s1c1
Sequence:CCGGGCGGAGTTTGTAGTCCTCTTTCTCGAGAAAGAGGACTACAAACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026917.4-455s1c1
Sequence:CCGGCCCAAAGGAAATGCCACTAAACTCGAGTTTAGTGGCATTTCCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026917
VALIDATED
ZDHHC3 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026917.4-1779s1c1
Sequence:CCGGCCCAGCAAGATGTCAGTCATTCTCGAGAATGACTGACATCTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026917.4-729s1c1
Sequence:CCGGGCTTTGAAGAAGACTGGACAACTCGAGTTGTCCAGTCTTCTTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026917.4-242s1c1
Sequence:CCGGGCCATGTGGTTTATCCGAGATCTCGAGATCTCGGATAAACCACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026917.4-311s1c1
Sequence:CCGGGCGGAGTTTGTAGTCCTCTTTCTCGAGAAAGAGGACTACAAACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026917.4-455s1c1
Sequence:CCGGCCCAAAGGAAATGCCACTAAACTCGAGTTTAGTGGCATTTCCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026917
VALIDATED
ZDHHC3 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026917.4-1779s1c1
Sequence:CCGGCCCAGCAAGATGTCAGTCATTCTCGAGAATGACTGACATCTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026917.4-729s1c1
Sequence:CCGGGCTTTGAAGAAGACTGGACAACTCGAGTTGTCCAGTCTTCTTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026917.4-242s1c1
Sequence:CCGGGCCATGTGGTTTATCCGAGATCTCGAGATCTCGGATAAACCACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026917.4-311s1c1
Sequence:CCGGGCGGAGTTTGTAGTCCTCTTTCTCGAGAAAGAGGACTACAAACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026917.4-455s1c1
Sequence:CCGGCCCAAAGGAAATGCCACTAAACTCGAGTTTAGTGGCATTTCCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks