EMAIL THIS PAGE TO A FRIEND

ZDHHC4

zinc finger, DHHC-type containing 4

Synonyms: ZNF374
UniProtKB ID: Q9NPG8, A4D2N9, Q53EV7, Q6FIB5, Q9H0R9
Gene ID:
Mouse(72881) zinc finger, DHHC domain containing 4
Rat(304291) zinc finger, DHHC-type containing 4
Zebrafish(561817) zinc finger, DHHC-type containing 4
domestic cat(101096527) zinc finger, DHHC-type containing 4
chicken(416561) zinc finger, DHHC-type containing 4
dog(479757) zinc finger, DHHC-type containing 4
cow(514338) zinc finger, DHHC-type containing 4
sheep(101116881) zinc finger, DHHC-type containing 4
naked mole-rat(101704757) zinc finger, DHHC-type containing 4
domestic guinea pig(100728706) zinc finger, DHHC-type containing 4
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018106 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018106 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018106 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028379 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028379 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028379 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018106 Rosetta Predictions human pricing
NM_001013123 Rosetta Predictions rat pricing
NM_028379 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018106 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174249 predicted 259
2 SASI_Hs01_00174250 predicted 841
3 SASI_Hs01_00174251 predicted 1026
4 SASI_Hs02_00351294 predicted 785
5 SASI_Hs01_00174253 predicted 940
6 SASI_Hs02_00351295 predicted 901
7 SASI_Hs01_00174254 predicted 871
8 SASI_Hs01_00174256 predicted 973
9 SASI_Hs01_00174257 predicted 252
10 SASI_Hs01_00174258 predicted 950
11 SASI_Hs01_00174252 predicted 999
12 SASI_Hs01_00174255 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013123 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050236 predicted 985
2 SASI_Rn01_00050237 predicted 600
3 SASI_Rn01_00050238 predicted 830
4 SASI_Rn01_00050239 predicted 705
5 SASI_Rn01_00050240 predicted 901
6 SASI_Rn01_00050242 predicted 624
7 SASI_Rn01_00050243 predicted 891
8 SASI_Rn01_00050244 predicted 459
9 SASI_Rn01_00050245 predicted 483
10 SASI_Rn02_00200831 predicted 218
11 SASI_Rn01_00050241 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028379 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103901 predicted 559
2 SASI_Mm01_00103902 predicted 1063
3 SASI_Mm01_00103903 predicted 510
4 SASI_Mm02_00333753 predicted 535
5 SASI_Mm01_00103904 predicted 605
6 SASI_Mm01_00103905 predicted 815
7 SASI_Mm01_00103906 predicted 475
8 SASI_Mm01_00103907 predicted 327
9 SASI_Mm01_00103908 predicted 1003
10 SASI_Mm01_00103909 predicted 662
11 SASI_Mm01_00103910 predicted 888
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018106
VALIDATED
ZDHHC4 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138940    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018106.2-1266s1c1
Sequence:CCGGGACTGCCTTTGAGCTGTAGTTCTCGAGAACTACAGCTCAAAGGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018106.2-381s1c1
Sequence:CCGGCATGGATTGCTTCATTACCTTCTCGAGAAGGTAATGAAGCAATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134624    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018106.2-673s1c1
Sequence:CCGGGCTCTACTTGTGATTTAAGGACTCGAGTCCTTAAATCACAAGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018106.2-1206s1c1
Sequence:CCGGGAGATCTTTCTACCTGCCTTTCTCGAGAAAGGCAGGTAGAAAGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018106.2-741s1c1
Sequence:CCGGCGTTTCGACCATCACTGTGTTCTCGAGAACACAGTGATGGTCGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136174    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018106.2-1486s1c1
Sequence:CCGGGATGACTTCTCAGAGGTTCTACTCGAGTAGAACCTCTGAGAAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018106.2-668s1c1
Sequence:CCGGGAGGTGCTCTACTTGTGATTTCTCGAGAAATCACAAGTAGAGCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_018106.2-376s1c1
Sequence:CCGGCCGTGCATGGATTGCTTCATTCTCGAGAATGAAGCAATCCATGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018106.3-739s21c1
Sequence:CCGGGAGGTGCTCTACTTGTGATTTCTCGAGAAATCACAAGTAGAGCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_018106.3-812s21c1
Sequence:CCGGCGTTTCGACCATCACTGTGTTCTCGAGAACACAGTGATGGTCGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018106.3-447s21c1
Sequence:CCGGCCGTGCATGGATTGCTTCATTCTCGAGAATGAAGCAATCCATGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018106.3-1277s21c1
Sequence:CCGGGAGATCTTTCTACCTGCCTTTCTCGAGAAAGGCAGGTAGAAAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018106
VALIDATED
ZDHHC4 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138940    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018106.2-1266s1c1
Sequence:CCGGGACTGCCTTTGAGCTGTAGTTCTCGAGAACTACAGCTCAAAGGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018106.2-381s1c1
Sequence:CCGGCATGGATTGCTTCATTACCTTCTCGAGAAGGTAATGAAGCAATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134624    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018106.2-673s1c1
Sequence:CCGGGCTCTACTTGTGATTTAAGGACTCGAGTCCTTAAATCACAAGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018106.2-1206s1c1
Sequence:CCGGGAGATCTTTCTACCTGCCTTTCTCGAGAAAGGCAGGTAGAAAGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018106.2-741s1c1
Sequence:CCGGCGTTTCGACCATCACTGTGTTCTCGAGAACACAGTGATGGTCGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136174    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018106.2-1486s1c1
Sequence:CCGGGATGACTTCTCAGAGGTTCTACTCGAGTAGAACCTCTGAGAAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018106.2-668s1c1
Sequence:CCGGGAGGTGCTCTACTTGTGATTTCTCGAGAAATCACAAGTAGAGCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_018106.2-376s1c1
Sequence:CCGGCCGTGCATGGATTGCTTCATTCTCGAGAATGAAGCAATCCATGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018106.3-739s21c1
Sequence:CCGGGAGGTGCTCTACTTGTGATTTCTCGAGAAATCACAAGTAGAGCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_018106.3-812s21c1
Sequence:CCGGCGTTTCGACCATCACTGTGTTCTCGAGAACACAGTGATGGTCGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018106.3-447s21c1
Sequence:CCGGCCGTGCATGGATTGCTTCATTCTCGAGAATGAAGCAATCCATGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018106.3-1277s21c1
Sequence:CCGGGAGATCTTTCTACCTGCCTTTCTCGAGAAAGGCAGGTAGAAAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018106
VALIDATED
ZDHHC4 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138940    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018106.2-1266s1c1
Sequence:CCGGGACTGCCTTTGAGCTGTAGTTCTCGAGAACTACAGCTCAAAGGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018106.2-381s1c1
Sequence:CCGGCATGGATTGCTTCATTACCTTCTCGAGAAGGTAATGAAGCAATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134624    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018106.2-673s1c1
Sequence:CCGGGCTCTACTTGTGATTTAAGGACTCGAGTCCTTAAATCACAAGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018106.2-1206s1c1
Sequence:CCGGGAGATCTTTCTACCTGCCTTTCTCGAGAAAGGCAGGTAGAAAGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018106.2-741s1c1
Sequence:CCGGCGTTTCGACCATCACTGTGTTCTCGAGAACACAGTGATGGTCGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136174    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018106.2-1486s1c1
Sequence:CCGGGATGACTTCTCAGAGGTTCTACTCGAGTAGAACCTCTGAGAAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018106.2-668s1c1
Sequence:CCGGGAGGTGCTCTACTTGTGATTTCTCGAGAAATCACAAGTAGAGCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_018106.2-376s1c1
Sequence:CCGGCCGTGCATGGATTGCTTCATTCTCGAGAATGAAGCAATCCATGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018106.3-739s21c1
Sequence:CCGGGAGGTGCTCTACTTGTGATTTCTCGAGAAATCACAAGTAGAGCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_018106.3-812s21c1
Sequence:CCGGCGTTTCGACCATCACTGTGTTCTCGAGAACACAGTGATGGTCGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018106.3-447s21c1
Sequence:CCGGCCGTGCATGGATTGCTTCATTCTCGAGAATGAAGCAATCCATGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018106.3-1277s21c1
Sequence:CCGGGAGATCTTTCTACCTGCCTTTCTCGAGAAAGGCAGGTAGAAAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028379
VALIDATED
ZDHHC4 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028379.1-668s1c1
Sequence:CCGGCGATGATGTGATGTTTCCAAACTCGAGTTTGGAAACATCACATCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028379.1-815s1c1
Sequence:CCGGGAACACCAGGTACTTCCTCATCTCGAGATGAGGAAGTACCTGGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028379.1-818s1c1
Sequence:CCGGCACCAGGTACTTCCTCATTTACTCGAGTAAATGAGGAAGTACCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028379.4-819s21c1
Sequence:CCGGCACCAGGTACTTCCTCATTTACTCGAGTAAATGAGGAAGTACCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028379.4-628s21c1
Sequence:CCGGACTAAAGCAAACGAATCATTTCTCGAGAAATGATTCGTTTGCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028379.4-919s1c1
Sequence:CCGGGATCTCTACCAGGAAACTTACCTCGAGGTAAGTTTCCTGGTAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028379.4-278s21c1
Sequence:CCGGACTTGGCCTTCTTATTGATTTCTCGAGAAATCAATAAGAAGGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028379.4-1106s21c1
Sequence:CCGGCCACAAATGAATGGTATAAAGCTCGAGCTTTATACCATTCATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028379.4-470s21c1
Sequence:CCGGTCTTGCAAGGGCTAGTGTATGCTCGAGCATACACTAGCCCTTGCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028379
VALIDATED
ZDHHC4 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028379.1-668s1c1
Sequence:CCGGCGATGATGTGATGTTTCCAAACTCGAGTTTGGAAACATCACATCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028379.1-815s1c1
Sequence:CCGGGAACACCAGGTACTTCCTCATCTCGAGATGAGGAAGTACCTGGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028379.1-818s1c1
Sequence:CCGGCACCAGGTACTTCCTCATTTACTCGAGTAAATGAGGAAGTACCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028379.4-819s21c1
Sequence:CCGGCACCAGGTACTTCCTCATTTACTCGAGTAAATGAGGAAGTACCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028379.4-628s21c1
Sequence:CCGGACTAAAGCAAACGAATCATTTCTCGAGAAATGATTCGTTTGCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028379.4-919s1c1
Sequence:CCGGGATCTCTACCAGGAAACTTACCTCGAGGTAAGTTTCCTGGTAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028379.4-278s21c1
Sequence:CCGGACTTGGCCTTCTTATTGATTTCTCGAGAAATCAATAAGAAGGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028379.4-1106s21c1
Sequence:CCGGCCACAAATGAATGGTATAAAGCTCGAGCTTTATACCATTCATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028379.4-470s21c1
Sequence:CCGGTCTTGCAAGGGCTAGTGTATGCTCGAGCATACACTAGCCCTTGCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028379
VALIDATED
ZDHHC4 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028379.1-668s1c1
Sequence:CCGGCGATGATGTGATGTTTCCAAACTCGAGTTTGGAAACATCACATCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028379.1-815s1c1
Sequence:CCGGGAACACCAGGTACTTCCTCATCTCGAGATGAGGAAGTACCTGGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028379.1-818s1c1
Sequence:CCGGCACCAGGTACTTCCTCATTTACTCGAGTAAATGAGGAAGTACCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028379.4-819s21c1
Sequence:CCGGCACCAGGTACTTCCTCATTTACTCGAGTAAATGAGGAAGTACCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028379.4-628s21c1
Sequence:CCGGACTAAAGCAAACGAATCATTTCTCGAGAAATGATTCGTTTGCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028379.4-919s1c1
Sequence:CCGGGATCTCTACCAGGAAACTTACCTCGAGGTAAGTTTCCTGGTAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028379.4-278s21c1
Sequence:CCGGACTTGGCCTTCTTATTGATTTCTCGAGAAATCAATAAGAAGGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028379.4-1106s21c1
Sequence:CCGGCCACAAATGAATGGTATAAAGCTCGAGCTTTATACCATTCATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028379.4-470s21c1
Sequence:CCGGTCTTGCAAGGGCTAGTGTATGCTCGAGCATACACTAGCCCTTGCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks