EMAIL THIS PAGE TO A FRIEND

ZDHHC5

zinc finger, DHHC-type containing 5

Synonyms: DHHC5 ZNF375
UniProtKB ID: Q9C0B5, Q2TGF0, Q6ZMF0, Q8TAK8, Q9H923, Q9UFI7
Gene ID:
Mouse(228136) zinc finger, DHHC domain containing 5
Rat(362156) zinc finger, DHHC-type containing 5
chicken(423130) zinc finger, DHHC-type containing 5
dog(483490) zinc finger, DHHC-type containing 5
domestic cat(101091476) zinc finger, DHHC-type containing 5
domestic guinea pig(100721306) zinc finger, DHHC-type containing 5
naked mole-rat(101721837) zinc finger, DHHC-type containing 5
cow(533250) zinc finger, DHHC-type containing 5
sheep(101121968) zinc finger, DHHC-type containing 5
116 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144887 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144887 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144887 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015457 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015457 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015457 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015457 Rosetta Predictions human pricing
NM_001039338 Rosetta Predictions rat pricing
NM_144887 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034399 predicted 2219
2 SASI_Hs01_00034400 predicted 2261
3 SASI_Hs01_00034402 predicted 2072
4 SASI_Hs01_00034403 predicted 2889
5 SASI_Hs01_00034404 predicted 2017
6 SASI_Hs01_00034406 predicted 3141
7 SASI_Hs01_00034407 predicted 1806
8 SASI_Hs01_00034408 predicted 2851
9 SASI_Hs02_00347868 predicted 1965
10 SASI_Hs02_00347869 predicted 1621
11 SASI_Hs01_00034401 predicted 3018
12 SASI_Hs01_00034405 predicted 3217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039338 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045611 predicted 1301
2 SASI_Rn02_00204817 predicted 1590
3 SASI_Rn01_00045612 predicted 2163
4 SASI_Rn02_00204818 predicted 748
5 SASI_Rn01_00045613 predicted 1615
6 SASI_Rn01_00045615 predicted 312
7 SASI_Rn02_00204819 predicted 1286
8 SASI_Rn01_00045616 predicted 541
9 SASI_Rn01_00045617 predicted 1582
10 SASI_Rn01_00045618 predicted 1212
11 SASI_Rn01_00045614 predicted 1513
12 SASI_Rn01_00045619 predicted 705
13 SASI_Rn01_00045620 predicted 2441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144887 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178655 predicted 2704
2 SASI_Mm01_00178656 predicted 2202
3 SASI_Mm01_00178657 predicted 2489
4 SASI_Mm01_00178658 predicted 3060
5 SASI_Mm01_00178659 predicted 1208
6 SASI_Mm02_00340337 predicted 2458
7 SASI_Mm01_00178660 predicted 1238
8 SASI_Mm01_00178661 predicted 3224
9 SASI_Mm01_00178662 predicted 1291
10 SASI_Mm02_00340338 predicted 2182
11 SASI_Mm01_00178663 predicted 2523
12 SASI_Mm01_00178664 predicted 1450
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144887
VALIDATED
ZDHHC5 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144887.4-1282s21c1
Sequence:CCGGGTCTCAGCAGCCGCCATATTTCTCGAGAAATATGGCGGCTGCTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313387    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144887.4-3656s21c1
Sequence:CCGGCTGGAGGGAACCAGATCATTTCTCGAGAAATGATCTGGTTCCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144887.4-2990s21c1
Sequence:CCGGCCTCAGATGATTCCAAGAGATCTCGAGATCTCTTGGAATCATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144887.4-1374s21c1
Sequence:CCGGGCCCATTTACAATGCAATTATCTCGAGATAATTGCATTGTAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144887.4-1886s21c1
Sequence:CCGGATGAACAGGTTACAGGTAAATCTCGAGATTTACCTGTAACCTGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144887.3-1244s1c1
Sequence:CCGGGCCCATTTACAATGCAATTATCTCGAGATAATTGCATTGTAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144887.3-1575s1c1
Sequence:CCGGGCTCACATCATGGGTGTGTTTCTCGAGAAACACACCCATGATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144887.3-4308s1c1
Sequence:CCGGGCCTCTATACAGAGACCCTTTCTCGAGAAAGGGTCTCTGTATAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144887.3-1746s1c1
Sequence:CCGGCGCACAACCAATGAACAGGTTCTCGAGAACCTGTTCATTGGTTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144887.3-2860s1c1
Sequence:CCGGCCTCAGATGATTCCAAGAGATCTCGAGATCTCTTGGAATCATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144887
VALIDATED
ZDHHC5 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144887.4-1282s21c1
Sequence:CCGGGTCTCAGCAGCCGCCATATTTCTCGAGAAATATGGCGGCTGCTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313387    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144887.4-3656s21c1
Sequence:CCGGCTGGAGGGAACCAGATCATTTCTCGAGAAATGATCTGGTTCCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144887.4-2990s21c1
Sequence:CCGGCCTCAGATGATTCCAAGAGATCTCGAGATCTCTTGGAATCATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144887.4-1374s21c1
Sequence:CCGGGCCCATTTACAATGCAATTATCTCGAGATAATTGCATTGTAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144887.4-1886s21c1
Sequence:CCGGATGAACAGGTTACAGGTAAATCTCGAGATTTACCTGTAACCTGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144887.3-1244s1c1
Sequence:CCGGGCCCATTTACAATGCAATTATCTCGAGATAATTGCATTGTAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144887.3-1575s1c1
Sequence:CCGGGCTCACATCATGGGTGTGTTTCTCGAGAAACACACCCATGATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144887.3-4308s1c1
Sequence:CCGGGCCTCTATACAGAGACCCTTTCTCGAGAAAGGGTCTCTGTATAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144887.3-1746s1c1
Sequence:CCGGCGCACAACCAATGAACAGGTTCTCGAGAACCTGTTCATTGGTTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144887.3-2860s1c1
Sequence:CCGGCCTCAGATGATTCCAAGAGATCTCGAGATCTCTTGGAATCATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144887
VALIDATED
ZDHHC5 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144887.4-1282s21c1
Sequence:CCGGGTCTCAGCAGCCGCCATATTTCTCGAGAAATATGGCGGCTGCTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313387    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144887.4-3656s21c1
Sequence:CCGGCTGGAGGGAACCAGATCATTTCTCGAGAAATGATCTGGTTCCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144887.4-2990s21c1
Sequence:CCGGCCTCAGATGATTCCAAGAGATCTCGAGATCTCTTGGAATCATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144887.4-1374s21c1
Sequence:CCGGGCCCATTTACAATGCAATTATCTCGAGATAATTGCATTGTAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144887.4-1886s21c1
Sequence:CCGGATGAACAGGTTACAGGTAAATCTCGAGATTTACCTGTAACCTGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144887.3-1244s1c1
Sequence:CCGGGCCCATTTACAATGCAATTATCTCGAGATAATTGCATTGTAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144887.3-1575s1c1
Sequence:CCGGGCTCACATCATGGGTGTGTTTCTCGAGAAACACACCCATGATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144887.3-4308s1c1
Sequence:CCGGGCCTCTATACAGAGACCCTTTCTCGAGAAAGGGTCTCTGTATAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144887.3-1746s1c1
Sequence:CCGGCGCACAACCAATGAACAGGTTCTCGAGAACCTGTTCATTGGTTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144887.3-2860s1c1
Sequence:CCGGCCTCAGATGATTCCAAGAGATCTCGAGATCTCTTGGAATCATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015457
VALIDATED
ZDHHC5 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 5
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015457.2-3221s21c1
Sequence:CCGGGCCATTACTGACACCCAAAGACTCGAGTCTTTGGGTGTCAGTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015457.2-3157s21c1
Sequence:CCGGCGATGTCTTACAGCAGCCAAACTCGAGTTTGGCTGCTGTAAGACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015457.2-3013s21c1
Sequence:CCGGCCTCAGATGATTCAAAGAGATCTCGAGATCTCTTTGAATCATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015457.2-2646s21c1
Sequence:CCGGCGCAATGGAAGCCTATCTTATCTCGAGATAAGATAGGCTTCCATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015457.2-1899s21c1
Sequence:CCGGCGCACAACCAATGAACAGGTTCTCGAGAACCTGTTCATTGGTTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015457.2-1899s1c1
Sequence:CCGGCGCACAACCAATGAACAGGTTCTCGAGAACCTGTTCATTGGTTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015457.2-3219s1c1
Sequence:CCGGCAGCCATTACTGACACCCAAACTCGAGTTTGGGTGTCAGTAATGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015457.2-3959s1c1
Sequence:CCGGCCAGTTACTAACTACGGAAATCTCGAGATTTCCGTAGTTAGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015457.2-3013s1c1
Sequence:CCGGCCTCAGATGATTCAAAGAGATCTCGAGATCTCTTTGAATCATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015457.2-2646s1c1
Sequence:CCGGCGCAATGGAAGCCTATCTTATCTCGAGATAAGATAGGCTTCCATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015457.2-3958s1c1
Sequence:CCGGCCCAGTTACTAACTACGGAAACTCGAGTTTCCGTAGTTAGTAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015457.2-3157s1c1
Sequence:CCGGCGATGTCTTACAGCAGCCAAACTCGAGTTTGGCTGCTGTAAGACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015457.2-3221s1c1
Sequence:CCGGGCCATTACTGACACCCAAAGACTCGAGTCTTTGGGTGTCAGTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015457.2-1728s1c1
Sequence:CCGGGCCCACATTATGGGTGTGTTTCTCGAGAAACACACCCATAATGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015457.2-4290s1c1
Sequence:CCGGGCCAGGAGAGAAGAATCCAAACTCGAGTTTGGATTCTTCTCTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015457
VALIDATED
ZDHHC5 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 5
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015457.2-3221s21c1
Sequence:CCGGGCCATTACTGACACCCAAAGACTCGAGTCTTTGGGTGTCAGTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015457.2-3157s21c1
Sequence:CCGGCGATGTCTTACAGCAGCCAAACTCGAGTTTGGCTGCTGTAAGACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015457.2-3013s21c1
Sequence:CCGGCCTCAGATGATTCAAAGAGATCTCGAGATCTCTTTGAATCATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015457.2-2646s21c1
Sequence:CCGGCGCAATGGAAGCCTATCTTATCTCGAGATAAGATAGGCTTCCATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015457.2-1899s21c1
Sequence:CCGGCGCACAACCAATGAACAGGTTCTCGAGAACCTGTTCATTGGTTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015457.2-1899s1c1
Sequence:CCGGCGCACAACCAATGAACAGGTTCTCGAGAACCTGTTCATTGGTTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015457.2-3219s1c1
Sequence:CCGGCAGCCATTACTGACACCCAAACTCGAGTTTGGGTGTCAGTAATGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015457.2-3959s1c1
Sequence:CCGGCCAGTTACTAACTACGGAAATCTCGAGATTTCCGTAGTTAGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015457.2-3013s1c1
Sequence:CCGGCCTCAGATGATTCAAAGAGATCTCGAGATCTCTTTGAATCATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015457.2-2646s1c1
Sequence:CCGGCGCAATGGAAGCCTATCTTATCTCGAGATAAGATAGGCTTCCATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015457.2-3958s1c1
Sequence:CCGGCCCAGTTACTAACTACGGAAACTCGAGTTTCCGTAGTTAGTAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015457.2-3157s1c1
Sequence:CCGGCGATGTCTTACAGCAGCCAAACTCGAGTTTGGCTGCTGTAAGACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015457.2-3221s1c1
Sequence:CCGGGCCATTACTGACACCCAAAGACTCGAGTCTTTGGGTGTCAGTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015457.2-1728s1c1
Sequence:CCGGGCCCACATTATGGGTGTGTTTCTCGAGAAACACACCCATAATGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015457.2-4290s1c1
Sequence:CCGGGCCAGGAGAGAAGAATCCAAACTCGAGTTTGGATTCTTCTCTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015457
VALIDATED
ZDHHC5 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 5
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015457.2-3221s21c1
Sequence:CCGGGCCATTACTGACACCCAAAGACTCGAGTCTTTGGGTGTCAGTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015457.2-3157s21c1
Sequence:CCGGCGATGTCTTACAGCAGCCAAACTCGAGTTTGGCTGCTGTAAGACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015457.2-3013s21c1
Sequence:CCGGCCTCAGATGATTCAAAGAGATCTCGAGATCTCTTTGAATCATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015457.2-2646s21c1
Sequence:CCGGCGCAATGGAAGCCTATCTTATCTCGAGATAAGATAGGCTTCCATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015457.2-1899s21c1
Sequence:CCGGCGCACAACCAATGAACAGGTTCTCGAGAACCTGTTCATTGGTTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015457.2-1899s1c1
Sequence:CCGGCGCACAACCAATGAACAGGTTCTCGAGAACCTGTTCATTGGTTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015457.2-3219s1c1
Sequence:CCGGCAGCCATTACTGACACCCAAACTCGAGTTTGGGTGTCAGTAATGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015457.2-3959s1c1
Sequence:CCGGCCAGTTACTAACTACGGAAATCTCGAGATTTCCGTAGTTAGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015457.2-3013s1c1
Sequence:CCGGCCTCAGATGATTCAAAGAGATCTCGAGATCTCTTTGAATCATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015457.2-2646s1c1
Sequence:CCGGCGCAATGGAAGCCTATCTTATCTCGAGATAAGATAGGCTTCCATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015457.2-3958s1c1
Sequence:CCGGCCCAGTTACTAACTACGGAAACTCGAGTTTCCGTAGTTAGTAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015457.2-3157s1c1
Sequence:CCGGCGATGTCTTACAGCAGCCAAACTCGAGTTTGGCTGCTGTAAGACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015457.2-3221s1c1
Sequence:CCGGGCCATTACTGACACCCAAAGACTCGAGTCTTTGGGTGTCAGTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015457.2-1728s1c1
Sequence:CCGGGCCCACATTATGGGTGTGTTTCTCGAGAAACACACCCATAATGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015457.2-4290s1c1
Sequence:CCGGGCCAGGAGAGAAGAATCCAAACTCGAGTTTGGATTCTTCTCTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks