EMAIL THIS PAGE TO A FRIEND

ZDHHC6

zinc finger, DHHC-type containing 6

Synonyms: ZNF376
UniProtKB ID: Q9H6R6, D3DRB6, Q53G45, Q96IV7, Q9H605
Gene ID:
Mouse(66980) zinc finger, DHHC domain containing 6
Rat(361771) zinc finger, DHHC-type containing 6
Zebrafish(324468) zinc finger, DHHC-type containing 6
domestic cat(101095135) zinc finger, DHHC-type containing 6
dog(477821) zinc finger, DHHC-type containing 6
chicken(423897) zinc finger, DHHC-type containing 6
cow(514158) zinc finger, DHHC-type containing 6
Goat(100861044) zinc finger, DHHC-type containing 6
sheep(101121730) zinc finger, DHHC-type containing 6
naked mole-rat(101719190) zinc finger, DHHC-type containing 6
Domestic Rabbit(100357602) zinc finger, DHHC-type containing 6
domestic guinea pig(100734742) zinc finger, DHHC-type containing 6
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025883 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025883 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025883 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022494 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022494 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022494 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022494 Rosetta Predictions human pricing
NM_001037652 Rosetta Predictions rat pricing
NM_001033573 Rosetta Predictions mouse pricing
NM_025883 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022494 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227934 predicted 1141
2 SASI_Hs01_00227935 predicted 699
3 SASI_Hs01_00227936 predicted 1507
4 SASI_Hs01_00227938 predicted 488
5 SASI_Hs01_00227939 predicted 649
6 SASI_Hs01_00227940 predicted 1731
7 SASI_Hs01_00227941 predicted 580
8 SASI_Hs02_00355808 predicted 884
9 SASI_Hs01_00227943 predicted 1748
10 SASI_Hs02_00355809 predicted 773
11 SASI_Hs01_00227937 predicted 1311
12 SASI_Hs01_00227942 predicted 1183
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037652 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035845 predicted 1710
2 SASI_Rn01_00035846 predicted 1653
3 SASI_Rn01_00035847 predicted 1144
4 SASI_Rn01_00035848 predicted 1010
5 SASI_Rn01_00035849 predicted 476
6 SASI_Rn01_00035850 predicted 1558
7 SASI_Rn01_00035852 predicted 558
8 SASI_Rn01_00035853 predicted 1464
9 SASI_Rn01_00035854 predicted 548
10 SASI_Rn02_00204534 predicted 740
11 SASI_Rn01_00035851 predicted 889
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033573 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288925 predicted 1301
2 SASI_Mm01_00176760 predicted 1689
3 SASI_Mm01_00176761 predicted 1361
4 SASI_Mm01_00176762 predicted 1821
5 SASI_Mm01_00176763 predicted 720
6 SASI_Mm01_00176764 predicted 645
7 SASI_Mm01_00176765 predicted 730
8 SASI_Mm01_00176766 predicted 1557
9 SASI_Mm01_00176767 predicted 1882
10 SASI_Mm01_00176768 predicted 898
11 SASI_Mm01_00176769 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025883 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329218 predicted 1190
2 SASI_Mm01_00165091 predicted 1576
3 SASI_Mm01_00165092 predicted 1245
4 SASI_Mm01_00165093 predicted 1704
5 SASI_Mm01_00165094 predicted 608
6 SASI_Mm01_00165095 predicted 531
7 SASI_Mm01_00165096 predicted 614
8 SASI_Mm01_00165097 predicted 1450
9 SASI_Mm01_00165098 predicted 1759
10 SASI_Mm01_00165099 predicted 784
11 SASI_Mm01_00165100 predicted 799
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025883
VALIDATED
ZDHHC6 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025883.2-664s1c1
Sequence:CCGGCCTTACATACAACTGGAGGAACTCGAGTTCCTCCAGTTGTATGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025883.2-1470s1c1
Sequence:CCGGCGCTATAAAGTCATAGAAGATCTCGAGATCTTCTATGACTTTATAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025883.2-2894s1c1
Sequence:CCGGCCATCATTTCTGTAGTGTGTACTCGAGTACACACTACAGAAATGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025883.2-1648s1c1
Sequence:CCGGCCTTCATAGAAGGTACTTCAACTCGAGTTGAAGTACCTTCTATGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435201    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025883.3-1813s21c1
Sequence:CCGGCAGAAATGTTTATTACCGTTTCTCGAGAAACGGTAATAAACATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025883.3-1702s21c1
Sequence:CCGGTCACTAAGTCTTCATTACTTGCTCGAGCAAGTAATGAAGACTTAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025883.3-1202s21c1
Sequence:CCGGCAACTGGATGAAGTCTTCATTCTCGAGAATGAAGACTTCATCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025883.3-1180s21c1
Sequence:CCGGTAAAGATCGCATTCAGTATTACTCGAGTAATACTGAATGCGATCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025883
VALIDATED
ZDHHC6 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025883.2-664s1c1
Sequence:CCGGCCTTACATACAACTGGAGGAACTCGAGTTCCTCCAGTTGTATGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025883.2-1470s1c1
Sequence:CCGGCGCTATAAAGTCATAGAAGATCTCGAGATCTTCTATGACTTTATAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025883.2-2894s1c1
Sequence:CCGGCCATCATTTCTGTAGTGTGTACTCGAGTACACACTACAGAAATGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025883.2-1648s1c1
Sequence:CCGGCCTTCATAGAAGGTACTTCAACTCGAGTTGAAGTACCTTCTATGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435201    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025883.3-1813s21c1
Sequence:CCGGCAGAAATGTTTATTACCGTTTCTCGAGAAACGGTAATAAACATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025883.3-1702s21c1
Sequence:CCGGTCACTAAGTCTTCATTACTTGCTCGAGCAAGTAATGAAGACTTAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025883.3-1202s21c1
Sequence:CCGGCAACTGGATGAAGTCTTCATTCTCGAGAATGAAGACTTCATCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025883.3-1180s21c1
Sequence:CCGGTAAAGATCGCATTCAGTATTACTCGAGTAATACTGAATGCGATCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025883
VALIDATED
ZDHHC6 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025883.2-664s1c1
Sequence:CCGGCCTTACATACAACTGGAGGAACTCGAGTTCCTCCAGTTGTATGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025883.2-1470s1c1
Sequence:CCGGCGCTATAAAGTCATAGAAGATCTCGAGATCTTCTATGACTTTATAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025883.2-2894s1c1
Sequence:CCGGCCATCATTTCTGTAGTGTGTACTCGAGTACACACTACAGAAATGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025883.2-1648s1c1
Sequence:CCGGCCTTCATAGAAGGTACTTCAACTCGAGTTGAAGTACCTTCTATGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435201    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025883.3-1813s21c1
Sequence:CCGGCAGAAATGTTTATTACCGTTTCTCGAGAAACGGTAATAAACATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025883.3-1702s21c1
Sequence:CCGGTCACTAAGTCTTCATTACTTGCTCGAGCAAGTAATGAAGACTTAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025883.3-1202s21c1
Sequence:CCGGCAACTGGATGAAGTCTTCATTCTCGAGAATGAAGACTTCATCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025883.3-1180s21c1
Sequence:CCGGTAAAGATCGCATTCAGTATTACTCGAGTAATACTGAATGCGATCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022494
VALIDATED
ZDHHC6 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 6
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000160734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022494.1-1050s1c1
Sequence:CCGGCCTTGGGATTAGCTTTAGGAACTCGAGTTCCTAAAGCTAATCCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022494.1-1411s1c1
Sequence:CCGGCCCTCTGAATAAAGGAATCAACTCGAGTTGATTCCTTTATTCAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160416    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022494.1-2026s1c1
Sequence:CCGGCCCTCAGTTGATATTTCTTATCTCGAGATAAGAAATATCAACTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022494.1-604s1c1
Sequence:CCGGGTTGATAAATTGGACTGTCATCTCGAGATGACAGTCCAATTTATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022494.1-704s1c1
Sequence:CCGGGATACCATGTATCTCCAGTATCTCGAGATACTGGAGATACATGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160302    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022494.1-1785s1c1
Sequence:CCGGCCTAGTGCCATGATTTAAATACTCGAGTATTTAAATCATGGCACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022494.1-1412s1c1
Sequence:CCGGCCTCTGAATAAAGGAATCAAACTCGAGTTTGATTCCTTTATTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022494.1-1046s21c1
Sequence:CCGGTTTGCCTTGGGATTAGCTTTACTCGAGTAAAGCTAATCCCAAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022494.1-1901s21c1
Sequence:CCGGCATTTCATCCAAGTAAGTTAACTCGAGTTAACTTACTTGGATGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022494.1-1232s21c1
Sequence:CCGGAGGAACTTTAAACAGGTATTTCTCGAGAAATACCTGTTTAAAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022494.1-1781s21c1
Sequence:CCGGGTGCCCTAGTGCCATGATTTACTCGAGTAAATCATGGCACTAGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022494.1-1508s21c1
Sequence:CCGGGGTTTACGATACTGGTTATATCTCGAGATATAACCAGTATCGTAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022494.1-872s21c1
Sequence:CCGGTTAGCACCACTGGGTTGTATCCTCGAGGATACAACCCAGTGGTGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022494.1-1360s21c1
Sequence:CCGGAGTCAGAAGTGTTCGCTATAACTCGAGTTATAGCGAACACTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022494.1-1451s21c1
Sequence:CCGGTGCACCGAAGAGCCTCGAATACTCGAGTATTCGAGGCTCTTCGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022494
VALIDATED
ZDHHC6 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 6
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000160734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022494.1-1050s1c1
Sequence:CCGGCCTTGGGATTAGCTTTAGGAACTCGAGTTCCTAAAGCTAATCCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022494.1-1411s1c1
Sequence:CCGGCCCTCTGAATAAAGGAATCAACTCGAGTTGATTCCTTTATTCAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160416    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022494.1-2026s1c1
Sequence:CCGGCCCTCAGTTGATATTTCTTATCTCGAGATAAGAAATATCAACTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022494.1-604s1c1
Sequence:CCGGGTTGATAAATTGGACTGTCATCTCGAGATGACAGTCCAATTTATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022494.1-704s1c1
Sequence:CCGGGATACCATGTATCTCCAGTATCTCGAGATACTGGAGATACATGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160302    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022494.1-1785s1c1
Sequence:CCGGCCTAGTGCCATGATTTAAATACTCGAGTATTTAAATCATGGCACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022494.1-1412s1c1
Sequence:CCGGCCTCTGAATAAAGGAATCAAACTCGAGTTTGATTCCTTTATTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022494.1-1046s21c1
Sequence:CCGGTTTGCCTTGGGATTAGCTTTACTCGAGTAAAGCTAATCCCAAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022494.1-1901s21c1
Sequence:CCGGCATTTCATCCAAGTAAGTTAACTCGAGTTAACTTACTTGGATGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022494.1-1232s21c1
Sequence:CCGGAGGAACTTTAAACAGGTATTTCTCGAGAAATACCTGTTTAAAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022494.1-1781s21c1
Sequence:CCGGGTGCCCTAGTGCCATGATTTACTCGAGTAAATCATGGCACTAGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022494.1-1508s21c1
Sequence:CCGGGGTTTACGATACTGGTTATATCTCGAGATATAACCAGTATCGTAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022494.1-872s21c1
Sequence:CCGGTTAGCACCACTGGGTTGTATCCTCGAGGATACAACCCAGTGGTGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022494.1-1360s21c1
Sequence:CCGGAGTCAGAAGTGTTCGCTATAACTCGAGTTATAGCGAACACTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022494.1-1451s21c1
Sequence:CCGGTGCACCGAAGAGCCTCGAATACTCGAGTATTCGAGGCTCTTCGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022494
VALIDATED
ZDHHC6 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 6
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000160734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022494.1-1050s1c1
Sequence:CCGGCCTTGGGATTAGCTTTAGGAACTCGAGTTCCTAAAGCTAATCCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022494.1-1411s1c1
Sequence:CCGGCCCTCTGAATAAAGGAATCAACTCGAGTTGATTCCTTTATTCAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160416    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022494.1-2026s1c1
Sequence:CCGGCCCTCAGTTGATATTTCTTATCTCGAGATAAGAAATATCAACTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022494.1-604s1c1
Sequence:CCGGGTTGATAAATTGGACTGTCATCTCGAGATGACAGTCCAATTTATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022494.1-704s1c1
Sequence:CCGGGATACCATGTATCTCCAGTATCTCGAGATACTGGAGATACATGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160302    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022494.1-1785s1c1
Sequence:CCGGCCTAGTGCCATGATTTAAATACTCGAGTATTTAAATCATGGCACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022494.1-1412s1c1
Sequence:CCGGCCTCTGAATAAAGGAATCAAACTCGAGTTTGATTCCTTTATTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022494.1-1046s21c1
Sequence:CCGGTTTGCCTTGGGATTAGCTTTACTCGAGTAAAGCTAATCCCAAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022494.1-1901s21c1
Sequence:CCGGCATTTCATCCAAGTAAGTTAACTCGAGTTAACTTACTTGGATGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022494.1-1232s21c1
Sequence:CCGGAGGAACTTTAAACAGGTATTTCTCGAGAAATACCTGTTTAAAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022494.1-1781s21c1
Sequence:CCGGGTGCCCTAGTGCCATGATTTACTCGAGTAAATCATGGCACTAGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022494.1-1508s21c1
Sequence:CCGGGGTTTACGATACTGGTTATATCTCGAGATATAACCAGTATCGTAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022494.1-872s21c1
Sequence:CCGGTTAGCACCACTGGGTTGTATCCTCGAGGATACAACCCAGTGGTGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022494.1-1360s21c1
Sequence:CCGGAGTCAGAAGTGTTCGCTATAACTCGAGTTATAGCGAACACTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022494.1-1451s21c1
Sequence:CCGGTGCACCGAAGAGCCTCGAATACTCGAGTATTCGAGGCTCTTCGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks