EMAIL THIS PAGE TO A FRIEND

ZDHHC7

zinc finger, DHHC-type containing 7

Synonyms: DHHC7 SERZ-B SERZ1 ZNF370
UniProtKB ID: Q9NXF8, D3DUM1, Q8WV42, Q9NVD8
Gene ID:
Mouse(102193) zinc finger, DHHC domain containing 7
Rat(170906) zinc finger, DHHC-type containing 7
domestic guinea pig(100715353) zinc finger, DHHC-type containing 7
naked mole-rat(101698576) zinc finger, DHHC-type containing 7
cow(617052) zinc finger, DHHC-type containing 7
sheep(100302557) zinc finger, DHHC-type containing 7
Zebrafish(436875) zinc finger, DHHC-type containing 7
chicken(415821) zinc finger, DHHC-type containing 7
dog(489676) zinc finger, DHHC-type containing 7
domestic cat(101083311) zinc finger, DHHC-type containing 7
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133967 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133967 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133967 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017740 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017740 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017740 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017740 Rosetta Predictions human pricing
NM_133394 Rosetta Predictions rat pricing
NM_133967 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017740 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033546 predicted 533
2 SASI_Hs01_00033547 predicted 1308
3 SASI_Hs01_00033548 predicted 1290
4 SASI_Hs01_00033549 predicted 409
5 SASI_Hs01_00033550 predicted 1201
6 SASI_Hs01_00033551 predicted 560
7 SASI_Hs01_00033552 predicted 988
8 SASI_Hs01_00033553 predicted 1057
9 SASI_Hs01_00033554 predicted 1070
10 SASI_Hs01_00033555 predicted 1548
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133394 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057989 predicted 372
2 SASI_Rn01_00057990 predicted 350
3 SASI_Rn01_00057991 predicted 748
4 SASI_Rn01_00057992 predicted 1236
5 SASI_Rn01_00057993 predicted 1053
6 SASI_Rn02_00267650 predicted 971
7 SASI_Rn01_00057994 predicted 509
8 SASI_Rn01_00057995 predicted 637
9 SASI_Rn02_00267651 predicted 931
10 SASI_Rn01_00057996 predicted 937
11 SASI_Rn01_00057988 predicted 490
12 SASI_Rn01_00057997 predicted 869
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133967 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122972 predicted 518
2 SASI_Mm01_00122973 predicted 546
3 SASI_Mm01_00122974 predicted 656
4 SASI_Mm01_00122975 predicted 526
5 SASI_Mm01_00122976 predicted 1213
6 SASI_Mm01_00122977 predicted 989
7 SASI_Mm01_00122978 predicted 556
8 SASI_Mm01_00122979 predicted 1145
9 SASI_Mm01_00122980 predicted 1527
10 SASI_Mm02_00339083 predicted 1104
11 SASI_Mm01_00122981 predicted 1040
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133967
VALIDATED
ZDHHC7 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 7
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133967.3-528s21c1
Sequence:CCGGCTCCTGACTGACAATGACAATCTCGAGATTGTCATTGTCAGTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133967.3-1209s21c1
Sequence:CCGGCACTCGATATGCAATGATGAACTCGAGTTCATCATTGCATATCGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133967.3-1018s21c1
Sequence:CCGGCCATGTACATAGCTCTGTCTTCTCGAGAAGACAGAGCTATGTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133967.3-663s21c1
Sequence:CCGGGCAGACTTCGTGGTGACCTTTCTCGAGAAAGGTCACCACGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133967.3-663s1c1
Sequence:CCGGGCAGACTTCGTGGTGACCTTTCTCGAGAAAGGTCACCACGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133967.3-1209s1c1
Sequence:CCGGCACTCGATATGCAATGATGAACTCGAGTTCATCATTGCATATCGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133967.3-528s1c1
Sequence:CCGGCTCCTGACTGACAATGACAATCTCGAGATTGTCATTGTCAGTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133967.3-1018s1c1
Sequence:CCGGCCATGTACATAGCTCTGTCTTCTCGAGAAGACAGAGCTATGTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124079    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133967.3-2009s1c1
Sequence:CCGGGCCTACTATGAATGTATCCTACTCGAGTAGGATACATTCATAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133967
VALIDATED
ZDHHC7 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 7
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133967.3-528s21c1
Sequence:CCGGCTCCTGACTGACAATGACAATCTCGAGATTGTCATTGTCAGTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133967.3-1209s21c1
Sequence:CCGGCACTCGATATGCAATGATGAACTCGAGTTCATCATTGCATATCGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133967.3-1018s21c1
Sequence:CCGGCCATGTACATAGCTCTGTCTTCTCGAGAAGACAGAGCTATGTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133967.3-663s21c1
Sequence:CCGGGCAGACTTCGTGGTGACCTTTCTCGAGAAAGGTCACCACGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133967.3-663s1c1
Sequence:CCGGGCAGACTTCGTGGTGACCTTTCTCGAGAAAGGTCACCACGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133967.3-1209s1c1
Sequence:CCGGCACTCGATATGCAATGATGAACTCGAGTTCATCATTGCATATCGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133967.3-528s1c1
Sequence:CCGGCTCCTGACTGACAATGACAATCTCGAGATTGTCATTGTCAGTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133967.3-1018s1c1
Sequence:CCGGCCATGTACATAGCTCTGTCTTCTCGAGAAGACAGAGCTATGTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124079    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133967.3-2009s1c1
Sequence:CCGGGCCTACTATGAATGTATCCTACTCGAGTAGGATACATTCATAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133967
VALIDATED
ZDHHC7 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 7
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133967.3-528s21c1
Sequence:CCGGCTCCTGACTGACAATGACAATCTCGAGATTGTCATTGTCAGTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133967.3-1209s21c1
Sequence:CCGGCACTCGATATGCAATGATGAACTCGAGTTCATCATTGCATATCGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133967.3-1018s21c1
Sequence:CCGGCCATGTACATAGCTCTGTCTTCTCGAGAAGACAGAGCTATGTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133967.3-663s21c1
Sequence:CCGGGCAGACTTCGTGGTGACCTTTCTCGAGAAAGGTCACCACGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133967.3-663s1c1
Sequence:CCGGGCAGACTTCGTGGTGACCTTTCTCGAGAAAGGTCACCACGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133967.3-1209s1c1
Sequence:CCGGCACTCGATATGCAATGATGAACTCGAGTTCATCATTGCATATCGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133967.3-528s1c1
Sequence:CCGGCTCCTGACTGACAATGACAATCTCGAGATTGTCATTGTCAGTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133967.3-1018s1c1
Sequence:CCGGCCATGTACATAGCTCTGTCTTCTCGAGAAGACAGAGCTATGTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124079    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133967.3-2009s1c1
Sequence:CCGGGCCTACTATGAATGTATCCTACTCGAGTAGGATACATTCATAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017740
VALIDATED
ZDHHC7 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 7
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_017740.1-1211s21c1
Sequence:CCGGCTTTGTGGGCTTCCGATTTAGCTCGAGCTAAATCGGAAGCCCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_017740.1-829s21c1
Sequence:CCGGACTGCCCGTGGGTGAACAATTCTCGAGAATTGTTCACCCACGGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_017740.1-995s21c1
Sequence:CCGGGATAACTGTAATCCTGTTGATCTCGAGATCAACAGGATTACAGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017740.1-1056s21c1
Sequence:CCGGGCAGTTATGTTTGGCACCCAACTCGAGTTGGGTGCCAAACATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_017740.1-1557s21c1
Sequence:CCGGGGGTTATTACATGGGTTATTCCTCGAGGAATAACCCATGTAATAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_017740.1-1717s1c1
Sequence:CCGGGCGTTTACATAGAAAGACGTTCTCGAGAACGTCTTTCTATGTAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143647    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_017740.1-2177s1c1
Sequence:CCGGCCAGCCAAATTAGCAGTGTATCTCGAGATACACTGCTAATTTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_017740.1-1056s1c1
Sequence:CCGGGCAGTTATGTTTGGCACCCAACTCGAGTTGGGTGCCAAACATAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017740.1-963s1c1
Sequence:CCGGCAGTGGACTGAATGCAGTGATCTCGAGATCACTGCATTCAGTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017740.1-678s1c1
Sequence:CCGGCCCAAAGGAAACGCTACGAAACTCGAGTTTCGTAGCGTTTCCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_017740.1-1158s1c1
Sequence:CCGGGAAGGGATGAAGTCCGTCTTTCTCGAGAAAGACGGACTTCATCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017740.1-539s1c1
Sequence:CCGGCTTCGTGGTGACTTTCGTCATCTCGAGATGACGAAAGTCACCACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017740.1-995s1c1
Sequence:CCGGGATAACTGTAATCCTGTTGATCTCGAGATCAACAGGATTACAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017740
VALIDATED
ZDHHC7 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 7
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_017740.1-1211s21c1
Sequence:CCGGCTTTGTGGGCTTCCGATTTAGCTCGAGCTAAATCGGAAGCCCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_017740.1-829s21c1
Sequence:CCGGACTGCCCGTGGGTGAACAATTCTCGAGAATTGTTCACCCACGGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_017740.1-995s21c1
Sequence:CCGGGATAACTGTAATCCTGTTGATCTCGAGATCAACAGGATTACAGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017740.1-1056s21c1
Sequence:CCGGGCAGTTATGTTTGGCACCCAACTCGAGTTGGGTGCCAAACATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_017740.1-1557s21c1
Sequence:CCGGGGGTTATTACATGGGTTATTCCTCGAGGAATAACCCATGTAATAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_017740.1-1717s1c1
Sequence:CCGGGCGTTTACATAGAAAGACGTTCTCGAGAACGTCTTTCTATGTAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143647    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_017740.1-2177s1c1
Sequence:CCGGCCAGCCAAATTAGCAGTGTATCTCGAGATACACTGCTAATTTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_017740.1-1056s1c1
Sequence:CCGGGCAGTTATGTTTGGCACCCAACTCGAGTTGGGTGCCAAACATAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017740.1-963s1c1
Sequence:CCGGCAGTGGACTGAATGCAGTGATCTCGAGATCACTGCATTCAGTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017740.1-678s1c1
Sequence:CCGGCCCAAAGGAAACGCTACGAAACTCGAGTTTCGTAGCGTTTCCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_017740.1-1158s1c1
Sequence:CCGGGAAGGGATGAAGTCCGTCTTTCTCGAGAAAGACGGACTTCATCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017740.1-539s1c1
Sequence:CCGGCTTCGTGGTGACTTTCGTCATCTCGAGATGACGAAAGTCACCACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017740.1-995s1c1
Sequence:CCGGGATAACTGTAATCCTGTTGATCTCGAGATCAACAGGATTACAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017740
VALIDATED
ZDHHC7 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 7
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_017740.1-1211s21c1
Sequence:CCGGCTTTGTGGGCTTCCGATTTAGCTCGAGCTAAATCGGAAGCCCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_017740.1-829s21c1
Sequence:CCGGACTGCCCGTGGGTGAACAATTCTCGAGAATTGTTCACCCACGGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_017740.1-995s21c1
Sequence:CCGGGATAACTGTAATCCTGTTGATCTCGAGATCAACAGGATTACAGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017740.1-1056s21c1
Sequence:CCGGGCAGTTATGTTTGGCACCCAACTCGAGTTGGGTGCCAAACATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_017740.1-1557s21c1
Sequence:CCGGGGGTTATTACATGGGTTATTCCTCGAGGAATAACCCATGTAATAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_017740.1-1717s1c1
Sequence:CCGGGCGTTTACATAGAAAGACGTTCTCGAGAACGTCTTTCTATGTAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143647    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_017740.1-2177s1c1
Sequence:CCGGCCAGCCAAATTAGCAGTGTATCTCGAGATACACTGCTAATTTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_017740.1-1056s1c1
Sequence:CCGGGCAGTTATGTTTGGCACCCAACTCGAGTTGGGTGCCAAACATAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017740.1-963s1c1
Sequence:CCGGCAGTGGACTGAATGCAGTGATCTCGAGATCACTGCATTCAGTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017740.1-678s1c1
Sequence:CCGGCCCAAAGGAAACGCTACGAAACTCGAGTTTCGTAGCGTTTCCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_017740.1-1158s1c1
Sequence:CCGGGAAGGGATGAAGTCCGTCTTTCTCGAGAAAGACGGACTTCATCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017740.1-539s1c1
Sequence:CCGGCTTCGTGGTGACTTTCGTCATCTCGAGATGACGAAAGTCACCACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017740.1-995s1c1
Sequence:CCGGGATAACTGTAATCCTGTTGATCTCGAGATCAACAGGATTACAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks