EMAIL THIS PAGE TO A FRIEND

ZDHHC8

zinc finger, DHHC-type containing 8

Synonyms: DHHC8 ZDHHCL1 ZNF378
UniProtKB ID: Q9ULC8, Q2TGE9, Q6ICL1, Q6ZNF5, Q7Z6L9
Gene ID:
Human(29801) Summary: This gene encodes a four transmembrane protein that is a member of the zinc finger DHHC domain-containing protein family. The encoded protein may function as a palmitoyltransferase. Defects in this gene may be associated with a susceptibility to schizophrenia. Alternate splicing of this gene results in multiple transcript variants. A pseudogene of this gene is found on chromosome 22.[provided by RefSeq, May 2010]
Mouse(27801) zinc finger, DHHC domain containing 8
Rat(303796) zinc finger, DHHC-type containing 8
chicken(416788) zinc finger, DHHC-type containing 8
Horse(100051594) zinc finger, DHHC-type containing 8
domestic cat(101095862) zinc finger, DHHC-type containing 8
dog(486415) zinc finger, DHHC-type containing 8
sheep(101122893) zinc finger, DHHC-type containing 8
naked mole-rat(101697065) zinc finger, DHHC-type containing 8
domestic guinea pig(100712959) zinc finger, DHHC-type containing 8
99 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013373 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013373 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013373 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172151 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172151 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172151 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU084861 MISSION® esiRNA esiRNA targeting mouse Zdhhc8 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013373 Rosetta Predictions human pricing
NM_001039021 Rosetta Predictions rat pricing
XM_001062535 Rosetta Predictions rat pricing
NM_172151 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013373 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146196 predicted 351
2 SASI_Hs01_00146197 predicted 389
3 SASI_Hs01_00146198 predicted 815
4 SASI_Hs01_00146199 predicted 2257
5 SASI_Hs01_00146200 predicted 1281
6 SASI_Hs02_00344717 predicted 395
7 SASI_Hs01_00146202 predicted 989
8 SASI_Hs01_00146203 predicted 2877
9 SASI_Hs01_00146204 predicted 654
10 SASI_Hs02_00344718 predicted 363
11 SASI_Hs01_00146201 predicted 2607
12 SASI_Hs01_00146205 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039021 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109654 predicted 2265
2 SASI_Rn01_00109655 predicted 988
3 SASI_Rn01_00109656 predicted 1291
4 SASI_Rn01_00109657 predicted 2416
5 SASI_Rn01_00109659 predicted 1547
6 SASI_Rn01_00109660 predicted 389
7 SASI_Rn02_00204759 predicted 687
8 SASI_Rn01_00109661 predicted 555
9 SASI_Rn01_00109662 predicted 1026
10 SASI_Rn01_00109663 predicted 1011
11 SASI_Rn01_00109658 predicted 2398
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062535 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00303763 predicted 2137
2 SASI_Rn02_00303764 predicted 866
3 SASI_Rn02_00303765 predicted 1158
4 SASI_Rn02_00303766 predicted 2288
5 SASI_Rn02_00303767 predicted 1420
6 SASI_Rn02_00303768 predicted 257
7 SASI_Rn02_00303769 predicted 559
8 SASI_Rn02_00303770 predicted 430
9 SASI_Rn02_00303771 predicted 896
10 SASI_Rn02_00303772 predicted 875
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172151 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100978 predicted 1079
2 SASI_Mm01_00100979 predicted 1288
3 SASI_Mm01_00100980 predicted 2687
4 SASI_Mm01_00100981 predicted 1613
5 SASI_Mm01_00100982 predicted 1292
6 SASI_Mm01_00100983 predicted 2264
7 SASI_Mm01_00100985 predicted 1541
8 SASI_Mm01_00100986 predicted 555
9 SASI_Mm01_00100987 predicted 2387
10 SASI_Mm02_00343698 predicted 1016
11 SASI_Mm01_00100984 predicted 1262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013373
VALIDATED
ZDHHC8 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013373.1-2258s1c1
Sequence:CCGGCCCAAGTAAGCTTAATGGGCACTCGAGTGCCCATTAAGCTTACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013373.1-950s1c1
Sequence:CCGGCAAGGTCAAGCTTAGTGACAACTCGAGTTGTCACTAAGCTTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159522    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013373.2-3103s1c1
Sequence:CCGGCAAAGCCTTAACCTTTGCTTTCTCGAGAAAGCAAAGGTTAAGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013373.1-257s1c1
Sequence:CCGGCAATGGCATCATCTTCCTCTTCTCGAGAAGAGGAAGATGATGCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013373.1-2260s1c1
Sequence:CCGGCAAGTAAGCTTAATGGGCAGTCTCGAGACTGCCCATTAAGCTTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013373.1-1159s1c1
Sequence:CCGGCACCTGCCATGTACAAGTTTACTCGAGTAAACTTGTACATGGCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013373.1-898s1c1
Sequence:CCGGGTTTGAAGCCGCCTTTCCTTACTCGAGTAAGGAAAGGCGGCTTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013373.1-374s1c1
Sequence:CCGGGCTGTACAAGAACGTGGATGTCTCGAGACATCCACGTTCTTGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013373.2-2338s1c1
Sequence:CCGGTACACGGCACACGCTGGTTAACTCGAGTTAACCAGCGTGTGCCGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013373
VALIDATED
ZDHHC8 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013373.1-2258s1c1
Sequence:CCGGCCCAAGTAAGCTTAATGGGCACTCGAGTGCCCATTAAGCTTACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013373.1-950s1c1
Sequence:CCGGCAAGGTCAAGCTTAGTGACAACTCGAGTTGTCACTAAGCTTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159522    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013373.2-3103s1c1
Sequence:CCGGCAAAGCCTTAACCTTTGCTTTCTCGAGAAAGCAAAGGTTAAGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013373.1-257s1c1
Sequence:CCGGCAATGGCATCATCTTCCTCTTCTCGAGAAGAGGAAGATGATGCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013373.1-2260s1c1
Sequence:CCGGCAAGTAAGCTTAATGGGCAGTCTCGAGACTGCCCATTAAGCTTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013373.1-1159s1c1
Sequence:CCGGCACCTGCCATGTACAAGTTTACTCGAGTAAACTTGTACATGGCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013373.1-898s1c1
Sequence:CCGGGTTTGAAGCCGCCTTTCCTTACTCGAGTAAGGAAAGGCGGCTTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013373.1-374s1c1
Sequence:CCGGGCTGTACAAGAACGTGGATGTCTCGAGACATCCACGTTCTTGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013373.2-2338s1c1
Sequence:CCGGTACACGGCACACGCTGGTTAACTCGAGTTAACCAGCGTGTGCCGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013373
VALIDATED
ZDHHC8 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013373.1-2258s1c1
Sequence:CCGGCCCAAGTAAGCTTAATGGGCACTCGAGTGCCCATTAAGCTTACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013373.1-950s1c1
Sequence:CCGGCAAGGTCAAGCTTAGTGACAACTCGAGTTGTCACTAAGCTTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159522    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013373.2-3103s1c1
Sequence:CCGGCAAAGCCTTAACCTTTGCTTTCTCGAGAAAGCAAAGGTTAAGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013373.1-257s1c1
Sequence:CCGGCAATGGCATCATCTTCCTCTTCTCGAGAAGAGGAAGATGATGCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013373.1-2260s1c1
Sequence:CCGGCAAGTAAGCTTAATGGGCAGTCTCGAGACTGCCCATTAAGCTTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013373.1-1159s1c1
Sequence:CCGGCACCTGCCATGTACAAGTTTACTCGAGTAAACTTGTACATGGCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013373.1-898s1c1
Sequence:CCGGGTTTGAAGCCGCCTTTCCTTACTCGAGTAAGGAAAGGCGGCTTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013373.1-374s1c1
Sequence:CCGGGCTGTACAAGAACGTGGATGTCTCGAGACATCCACGTTCTTGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013373.2-2338s1c1
Sequence:CCGGTACACGGCACACGCTGGTTAACTCGAGTTAACCAGCGTGTGCCGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172151
VALIDATED
ZDHHC8 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 8
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172151.2-429s1c1
Sequence:CCGGCCGCAACTACCGTTACTTCTTCTCGAGAAGAAGTAACGGTAGTTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172151.2-179s1c1
Sequence:CCGGCCAACTTCAGTATGGCTACCTCTCGAGAGGTAGCCATACTGAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172151.2-183s1c1
Sequence:CCGGCTTCAGTATGGCTACCTTCATCTCGAGATGAAGGTAGCCATACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172151.2-843s1c1
Sequence:CCGGCAAGGTCAAACTTAGCGACAACTCGAGTTGTCGCTAAGTTTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172151.2-1160s1c1
Sequence:CCGGCCCACAGTCTAGACTTTGTGTCTCGAGACACAAAGTCTAGACTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172151.2-133s1c1
Sequence:CCGGCCAGCTATTCCTGTCTACAATCTCGAGATTGTAGACAGGAATAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172151.4-839s21c1
Sequence:CCGGGGAACGTGGAGCACGTGTTATCTCGAGATAACACGTGCTCCACGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172151.4-2794s21c1
Sequence:CCGGCACGGCCTTTCACTGACAAAGCTCGAGCTTTGTCAGTGAAAGGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172151.4-971s21c1
Sequence:CCGGAGGTCAAACTTAGCGACAATGCTCGAGCATTGTCGCTAAGTTTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172151.4-1522s21c1
Sequence:CCGGCATGCACTGCCCAATCGAAATCTCGAGATTTCGATTGGGCAGTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172151.4-309s21c1
Sequence:CCGGCTTCAGTATGGCTACCTTCATCTCGAGATGAAGGTAGCCATACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172151
VALIDATED
ZDHHC8 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 8
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172151.2-429s1c1
Sequence:CCGGCCGCAACTACCGTTACTTCTTCTCGAGAAGAAGTAACGGTAGTTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172151.2-179s1c1
Sequence:CCGGCCAACTTCAGTATGGCTACCTCTCGAGAGGTAGCCATACTGAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172151.2-183s1c1
Sequence:CCGGCTTCAGTATGGCTACCTTCATCTCGAGATGAAGGTAGCCATACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172151.2-843s1c1
Sequence:CCGGCAAGGTCAAACTTAGCGACAACTCGAGTTGTCGCTAAGTTTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172151.2-1160s1c1
Sequence:CCGGCCCACAGTCTAGACTTTGTGTCTCGAGACACAAAGTCTAGACTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172151.2-133s1c1
Sequence:CCGGCCAGCTATTCCTGTCTACAATCTCGAGATTGTAGACAGGAATAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172151.4-839s21c1
Sequence:CCGGGGAACGTGGAGCACGTGTTATCTCGAGATAACACGTGCTCCACGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172151.4-2794s21c1
Sequence:CCGGCACGGCCTTTCACTGACAAAGCTCGAGCTTTGTCAGTGAAAGGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172151.4-971s21c1
Sequence:CCGGAGGTCAAACTTAGCGACAATGCTCGAGCATTGTCGCTAAGTTTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172151.4-1522s21c1
Sequence:CCGGCATGCACTGCCCAATCGAAATCTCGAGATTTCGATTGGGCAGTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172151.4-309s21c1
Sequence:CCGGCTTCAGTATGGCTACCTTCATCTCGAGATGAAGGTAGCCATACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172151
VALIDATED
ZDHHC8 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 8
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172151.2-429s1c1
Sequence:CCGGCCGCAACTACCGTTACTTCTTCTCGAGAAGAAGTAACGGTAGTTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172151.2-179s1c1
Sequence:CCGGCCAACTTCAGTATGGCTACCTCTCGAGAGGTAGCCATACTGAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172151.2-183s1c1
Sequence:CCGGCTTCAGTATGGCTACCTTCATCTCGAGATGAAGGTAGCCATACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172151.2-843s1c1
Sequence:CCGGCAAGGTCAAACTTAGCGACAACTCGAGTTGTCGCTAAGTTTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172151.2-1160s1c1
Sequence:CCGGCCCACAGTCTAGACTTTGTGTCTCGAGACACAAAGTCTAGACTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172151.2-133s1c1
Sequence:CCGGCCAGCTATTCCTGTCTACAATCTCGAGATTGTAGACAGGAATAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172151.4-839s21c1
Sequence:CCGGGGAACGTGGAGCACGTGTTATCTCGAGATAACACGTGCTCCACGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172151.4-2794s21c1
Sequence:CCGGCACGGCCTTTCACTGACAAAGCTCGAGCTTTGTCAGTGAAAGGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172151.4-971s21c1
Sequence:CCGGAGGTCAAACTTAGCGACAATGCTCGAGCATTGTCGCTAAGTTTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172151.4-1522s21c1
Sequence:CCGGCATGCACTGCCCAATCGAAATCTCGAGATTTCGATTGGGCAGTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172151.4-309s21c1
Sequence:CCGGCTTCAGTATGGCTACCTTCATCTCGAGATGAAGGTAGCCATACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks