EMAIL THIS PAGE TO A FRIEND

ZDHHC9

zinc finger, DHHC-type containing 9

Synonyms: CGI89 CXorf11 DHHC9 MMSA1 MRXSZ ZDHHC10 ZNF379 ZNF380
Gene ID:
Human(51114) Summary: This gene encodes an integral membrane protein that is a member of the zinc finger DHHC domain-containing protein family. The encoded protein forms a complex with golgin subfamily A member 7 and functions as a palmitoyltransferase. This protein specifically palmitoylates HRAS and NRAS. Mutations in this gene are associated with X-linked mental retardation. Alternate splicing results in multiple transcript variants that encode the same protein.[provided by RefSeq, May 2010]
Mouse(208884) zinc finger, DHHC domain containing 9
Rat(302808) zinc finger, DHHC-type containing 9
Zebrafish(560095) zinc finger, DHHC-type containing 9
chicken(422139) zinc finger, DHHC-type containing 9
dog(492126) zinc finger, DHHC-type containing 9
Horse(100054679) zinc finger, DHHC-type containing 9
domestic cat(101080366) zinc finger, DHHC-type containing 9
domestic guinea pig(100732062) zinc finger, DHHC-type containing 9
naked mole-rat(101725607) zinc finger, DHHC-type containing 9
cow(527885) zinc finger, DHHC-type containing 9
sheep(101120553) zinc finger, DHHC-type containing 9
166 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172465 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172465 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172465 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016032 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016032 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016032 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008222 Rosetta Predictions human pricing
NM_016032 Rosetta Predictions human pricing
NM_001039016 Rosetta Predictions rat pricing
NM_172465 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008222 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244245 predicted 1197
2 SASI_Hs01_00244246 predicted 1451
3 SASI_Hs01_00244247 predicted 1006
4 SASI_Hs01_00244249 predicted 733
5 SASI_Hs01_00244250 predicted 761
6 SASI_Hs01_00244251 predicted 1000
7 SASI_Hs01_00244252 predicted 1141
8 SASI_Hs01_00244253 predicted 1117
9 SASI_Hs02_00305380 predicted 1145
10 SASI_Hs02_00305381 predicted 899
11 SASI_Hs01_00244244 predicted 387
12 SASI_Hs01_00244248 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016032 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212731 predicted 1226
2 SASI_Hs01_00212732 predicted 1480
3 SASI_Hs01_00212733 predicted 1041
4 SASI_Hs01_00212735 predicted 770
5 SASI_Hs01_00212736 predicted 801
6 SASI_Hs01_00212737 predicted 1043
7 SASI_Hs01_00212738 predicted 1176
8 SASI_Hs01_00212739 predicted 1151
9 SASI_Hs02_00348738 predicted 1186
10 SASI_Hs02_00348739 predicted 938
11 SASI_Hs01_00212730 predicted 427
12 SASI_Hs01_00212734 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039016 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076215 predicted 332
2 SASI_Rn01_00076216 predicted 1102
3 SASI_Rn01_00076218 predicted 652
4 SASI_Rn01_00076219 predicted 528
5 SASI_Rn01_00076220 predicted 1083
6 SASI_Rn01_00076221 predicted 816
7 SASI_Rn01_00076222 predicted 687
8 SASI_Rn01_00076223 predicted 688
9 SASI_Rn02_00204746 predicted 538
10 SASI_Rn01_00076224 predicted 1060
11 SASI_Rn01_00076217 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172465 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065796 predicted 359
2 SASI_Mm01_00065797 predicted 1030
3 SASI_Mm01_00065798 predicted 707
4 SASI_Mm01_00065799 predicted 714
5 SASI_Mm01_00065800 predicted 1331
6 SASI_Mm01_00065801 predicted 477
7 SASI_Mm01_00065802 predicted 1128
8 SASI_Mm01_00065803 predicted 1115
9 SASI_Mm01_00065804 predicted 550
10 SASI_Mm01_00065805 predicted 879
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172465
VALIDATED
ZDHHC9 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172465.1-925s1c1
Sequence:CCGGCGCCTTTAACATCGTCTATGTCTCGAGACATAGACGATGTTAAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172465.1-904s1c1
Sequence:CCGGCCTCCTCACAATTTATGTCTTCTCGAGAAGACATAAATTGTGAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172465.1-1082s1c1
Sequence:CCGGCTCAATCAGACCACCAATGAACTCGAGTTCATTGGTGGTCTGATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172465.1-787s1c1
Sequence:CCGGCCATTGTAGCATCTGTGACAACTCGAGTTGTCACAGATGCTACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172465.1-724s1c1
Sequence:CCGGCAACCAGATTGTGAAACTGAACTCGAGTTCAGTTTCACAATCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172465
VALIDATED
ZDHHC9 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172465.1-925s1c1
Sequence:CCGGCGCCTTTAACATCGTCTATGTCTCGAGACATAGACGATGTTAAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172465.1-904s1c1
Sequence:CCGGCCTCCTCACAATTTATGTCTTCTCGAGAAGACATAAATTGTGAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172465.1-1082s1c1
Sequence:CCGGCTCAATCAGACCACCAATGAACTCGAGTTCATTGGTGGTCTGATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172465.1-787s1c1
Sequence:CCGGCCATTGTAGCATCTGTGACAACTCGAGTTGTCACAGATGCTACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172465.1-724s1c1
Sequence:CCGGCAACCAGATTGTGAAACTGAACTCGAGTTCAGTTTCACAATCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172465
VALIDATED
ZDHHC9 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172465.1-925s1c1
Sequence:CCGGCGCCTTTAACATCGTCTATGTCTCGAGACATAGACGATGTTAAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172465.1-904s1c1
Sequence:CCGGCCTCCTCACAATTTATGTCTTCTCGAGAAGACATAAATTGTGAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172465.1-1082s1c1
Sequence:CCGGCTCAATCAGACCACCAATGAACTCGAGTTCATTGGTGGTCTGATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172465.1-787s1c1
Sequence:CCGGCCATTGTAGCATCTGTGACAACTCGAGTTGTCACAGATGCTACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172465.1-724s1c1
Sequence:CCGGCAACCAGATTGTGAAACTGAACTCGAGTTCAGTTTCACAATCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016032
VALIDATED
ZDHHC9 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 9
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016032.1-789s1c1
Sequence:CCGGCCATTGCAGCATCTGTGACAACTCGAGTTGTCACAGATGCTGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016032.1-750s1c1
Sequence:CCGGCTGTTACACATGCAAGATCTTCTCGAGAAGATCTTGCATGTGTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016032.1-864s1c1
Sequence:CCGGGAGGAACTACCGCTACTTCTACTCGAGTAGAAGTAGCGGTAGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016032.1-1089s1c1
Sequence:CCGGCCAGACAACCAATGAAGACATCTCGAGATGTCTTCATTGGTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016032.1-1012s1c1
Sequence:CCGGGAAGTCCTCATTTGCTTCTTTCTCGAGAAAGAAGCAAATGAGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016032.1-333s1c1
Sequence:CCGGGTCTGTGATGGTGGTGAGAAACTCGAGTTTCTCACCACCATCACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016032
VALIDATED
ZDHHC9 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 9
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016032.1-789s1c1
Sequence:CCGGCCATTGCAGCATCTGTGACAACTCGAGTTGTCACAGATGCTGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016032.1-750s1c1
Sequence:CCGGCTGTTACACATGCAAGATCTTCTCGAGAAGATCTTGCATGTGTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016032.1-864s1c1
Sequence:CCGGGAGGAACTACCGCTACTTCTACTCGAGTAGAAGTAGCGGTAGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016032.1-1089s1c1
Sequence:CCGGCCAGACAACCAATGAAGACATCTCGAGATGTCTTCATTGGTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016032.1-1012s1c1
Sequence:CCGGGAAGTCCTCATTTGCTTCTTTCTCGAGAAAGAAGCAAATGAGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016032.1-333s1c1
Sequence:CCGGGTCTGTGATGGTGGTGAGAAACTCGAGTTTCTCACCACCATCACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016032
VALIDATED
ZDHHC9 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 9
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016032.1-789s1c1
Sequence:CCGGCCATTGCAGCATCTGTGACAACTCGAGTTGTCACAGATGCTGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016032.1-750s1c1
Sequence:CCGGCTGTTACACATGCAAGATCTTCTCGAGAAGATCTTGCATGTGTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016032.1-864s1c1
Sequence:CCGGGAGGAACTACCGCTACTTCTACTCGAGTAGAAGTAGCGGTAGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016032.1-1089s1c1
Sequence:CCGGCCAGACAACCAATGAAGACATCTCGAGATGTCTTCATTGGTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016032.1-1012s1c1
Sequence:CCGGGAAGTCCTCATTTGCTTCTTTCTCGAGAAAGAAGCAAATGAGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016032.1-333s1c1
Sequence:CCGGGTCTGTGATGGTGGTGAGAAACTCGAGTTTCTCACCACCATCACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks