EMAIL THIS PAGE TO A FRIEND

ZEB1

zinc finger E-box binding homeobox 1

Synonyms: AREB6 BZP DELTAEF1 FECD6 NIL2A PPCD3 TCF8 ZFHEP ZFHX1A
Gene ID:
Human(6935) Summary: This gene encodes a zinc finger transcription factor. The encoded protein likely plays a role in transcriptional repression of interleukin 2. Mutations in this gene have been associated with posterior polymorphous corneal dystrophy-3 and late-onset Fuchs endothelial corneal dystrophy. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Mar 2010]
Mouse(21417) zinc finger E-box binding homeobox 1
Rat(25705) zinc finger E-box binding homeobox 1
chicken(396029) zinc finger E-box binding homeobox 1
dog(477966) zinc finger E-box binding homeobox 1
domestic cat(101091377) zinc finger E-box binding homeobox 1
cow(535183) zinc finger E-box binding homeobox 1
sheep(101115891) zinc finger E-box binding homeobox 1
naked mole-rat(101715661) zinc finger E-box binding homeobox 1
domestic guinea pig(100724924) zinc finger E-box binding homeobox 1
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030751 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030751 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030751 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011546 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011546 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011546 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128128 Rosetta Predictions human pricing
NM_030751 Rosetta Predictions human pricing
NM_013164 Rosetta Predictions rat pricing
XM_001056207 Rosetta Predictions rat pricing
NM_011546 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128128 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330526 predicted 2227
2 SASI_Hs02_00330527 predicted 1476
3 SASI_Hs02_00330528 predicted 2136
4 SASI_Hs02_00330529 predicted 1178
5 SASI_Hs02_00330530 predicted 853
6 SASI_Hs02_00330531 predicted 1549
7 SASI_Hs02_00330532 predicted 1714
8 SASI_Hs02_00330533 predicted 1667
9 SASI_Hs02_00330534 predicted 1250
10 SASI_Hs02_00330535 predicted 2637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111598 predicted 1906
2 SASI_Hs01_00111599 predicted 1155
3 SASI_Hs02_00358262 predicted 1819
4 SASI_Hs01_00111601 predicted 860
5 SASI_Hs01_00111602 predicted 534
6 SASI_Hs01_00111603 predicted 1227
7 SASI_Hs01_00111605 predicted 1394
8 SASI_Hs02_00358263 predicted 1348
9 SASI_Hs02_00358264 predicted 928
10 SASI_Hs02_00358265 predicted 2313
11 SASI_Hs01_00111600 predicted 2256
12 SASI_Hs01_00111604 predicted 2671
13 SASI_Hs01_00111606 predicted 640
14 SASI_Hs01_00111607 predicted 2823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013164 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072609 predicted 1443
2 SASI_Rn01_00072610 predicted 743
3 SASI_Rn01_00072612 predicted 2544
4 SASI_Rn01_00072613 predicted 815
5 SASI_Rn01_00072614 predicted 2428
6 SASI_Rn02_00260986 predicted 2391
7 SASI_Rn01_00072615 predicted 493
8 SASI_Rn01_00072616 predicted 1902
9 SASI_Rn02_00260987 predicted 900
10 SASI_Rn01_00072617 predicted 1565
11 SASI_Rn01_00072608 predicted 2487
12 SASI_Rn01_00072611 predicted 1305
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056207 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282428 predicted 2247
2 SASI_Rn02_00282429 predicted 1555
3 SASI_Rn02_00282430 predicted 3350
4 SASI_Rn02_00282431 predicted 1625
5 SASI_Rn02_00282432 predicted 3240
6 SASI_Rn02_00282433 predicted 1352
7 SASI_Rn02_00282434 predicted 1131
8 SASI_Rn02_00282435 predicted 2709
9 SASI_Rn02_00282436 predicted 2367
10 SASI_Rn02_00282437 predicted 2272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011546 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320896 predicted 1027
2 SASI_Mm01_00144364 predicted 564
3 SASI_Mm01_00144365 predicted 792
4 SASI_Mm02_00320897 predicted 804
5 SASI_Mm01_00144366 predicted 1095
6 SASI_Mm01_00144367 predicted 350
7 SASI_Mm01_00144368 predicted 601
8 SASI_Mm01_00144369 predicted 2183
9 SASI_Mm01_00144370 predicted 815
10 SASI_Mm01_00144371 predicted 714
11 SASI_Mm01_00144372 predicted 2447
12 SASI_Mm01_00144373 predicted 1339
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030751
VALIDATED
ZEB1 MISSION shRNA Bacterial Glycerol Stock
zinc finger E-box binding homeobox 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030751.2-2512s1c1
Sequence:CCGGGCTGCCAATAAGCAAACGATTCTCGAGAATCGTTTGCTTATTGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030751.2-572s1c1
Sequence:CCGGCCTCTCTGAAAGAACACATTACTCGAGTAATGTGTTCTTTCAGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_030751.2-1201s1c1
Sequence:CCGGGCTGTTGTTCTGCCAACAGTTCTCGAGAACTGTTGGCAGAACAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030751.2-70s1c1
Sequence:CCGGCGGCGCAATAACGTTACAAATCTCGAGATTTGTAACGTTATTGCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030751.4-762s21c1
Sequence:CCGGGTCTGGGTGTAATCGTAAATTCTCGAGAATTTACGATTACACCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030751.4-3755s21c1
Sequence:CCGGGGTTAAAGGAAGCTGATTAATCTCGAGATTAATCAGCTTCCTTTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030751.4-583s21c1
Sequence:CCGGTATTGTGATAGAGGCTATAAACTCGAGTTTATAGCCTCTATCACAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030751.4-1920s21c1
Sequence:CCGGCCTACCACTGGATGTAGTAAACTCGAGTTTACTACATCCAGTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030751.4-1268s21c1
Sequence:CCGGTGTCTCCCATAAGTATCAATTCTCGAGAATTGATACTTATGGGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369266    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030751.4-3646s21c1
Sequence:CCGGCTGAACCTCAGACCTAGTAATCTCGAGATTACTAGGTCTGAGGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030751
VALIDATED
ZEB1 MISSION shRNA shRNA Plasmid DNA
zinc finger E-box binding homeobox 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030751.2-2512s1c1
Sequence:CCGGGCTGCCAATAAGCAAACGATTCTCGAGAATCGTTTGCTTATTGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030751.2-572s1c1
Sequence:CCGGCCTCTCTGAAAGAACACATTACTCGAGTAATGTGTTCTTTCAGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_030751.2-1201s1c1
Sequence:CCGGGCTGTTGTTCTGCCAACAGTTCTCGAGAACTGTTGGCAGAACAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030751.2-70s1c1
Sequence:CCGGCGGCGCAATAACGTTACAAATCTCGAGATTTGTAACGTTATTGCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030751.4-762s21c1
Sequence:CCGGGTCTGGGTGTAATCGTAAATTCTCGAGAATTTACGATTACACCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030751.4-3755s21c1
Sequence:CCGGGGTTAAAGGAAGCTGATTAATCTCGAGATTAATCAGCTTCCTTTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030751.4-583s21c1
Sequence:CCGGTATTGTGATAGAGGCTATAAACTCGAGTTTATAGCCTCTATCACAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030751.4-1920s21c1
Sequence:CCGGCCTACCACTGGATGTAGTAAACTCGAGTTTACTACATCCAGTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030751.4-1268s21c1
Sequence:CCGGTGTCTCCCATAAGTATCAATTCTCGAGAATTGATACTTATGGGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369266    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030751.4-3646s21c1
Sequence:CCGGCTGAACCTCAGACCTAGTAATCTCGAGATTACTAGGTCTGAGGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030751
VALIDATED
ZEB1 MISSION shRNA Lentiviral Transduction Particles
zinc finger E-box binding homeobox 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030751.2-2512s1c1
Sequence:CCGGGCTGCCAATAAGCAAACGATTCTCGAGAATCGTTTGCTTATTGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030751.2-572s1c1
Sequence:CCGGCCTCTCTGAAAGAACACATTACTCGAGTAATGTGTTCTTTCAGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_030751.2-1201s1c1
Sequence:CCGGGCTGTTGTTCTGCCAACAGTTCTCGAGAACTGTTGGCAGAACAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030751.2-70s1c1
Sequence:CCGGCGGCGCAATAACGTTACAAATCTCGAGATTTGTAACGTTATTGCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030751.4-762s21c1
Sequence:CCGGGTCTGGGTGTAATCGTAAATTCTCGAGAATTTACGATTACACCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030751.4-3755s21c1
Sequence:CCGGGGTTAAAGGAAGCTGATTAATCTCGAGATTAATCAGCTTCCTTTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030751.4-583s21c1
Sequence:CCGGTATTGTGATAGAGGCTATAAACTCGAGTTTATAGCCTCTATCACAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030751.4-1920s21c1
Sequence:CCGGCCTACCACTGGATGTAGTAAACTCGAGTTTACTACATCCAGTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030751.4-1268s21c1
Sequence:CCGGTGTCTCCCATAAGTATCAATTCTCGAGAATTGATACTTATGGGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369266    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030751.4-3646s21c1
Sequence:CCGGCTGAACCTCAGACCTAGTAATCTCGAGATTACTAGGTCTGAGGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011546
VALIDATED
ZEB1 MISSION shRNA Bacterial Glycerol Stock
zinc finger E-box binding homeobox 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011546.1-1007s1c1
Sequence:CCGGCCTGTGGATTATGAGTTCAAACTCGAGTTTGAACTCATAATCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011546.1-770s1c1
Sequence:CCGGCCGAACTGCAAGAAACGGTTTCTCGAGAAACCGTTTCTTGCAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011546.1-1899s1c1
Sequence:CCGGCCGGGTCAGTAAACATACCTACTCGAGTAGGTATGTTTACTGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011546.1-2349s1c1
Sequence:CCGGCCATAAACATTGCTATTCCTACTCGAGTAGGAATAGCAATGTTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011546.1-2785s1c1
Sequence:CCGGGCATCATTTGATTGAGCACATCTCGAGATGTGCTCAATCAAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011546.2-355s21c1
Sequence:CCGGACAAGACACCGCCGTCATTTACTCGAGTAAATGACGGCGGTGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011546.2-2200s21c1
Sequence:CCGGGTCGACAGTCAGTAGCGTTTACTCGAGTAAACGCTACTGACTGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235852    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011546.2-3529s21c1
Sequence:CCGGGAACCTCAAACCTAGTAATTTCTCGAGAAATTACTAGGTTTGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011546.2-2442s21c1
Sequence:CCGGCCGCCAACAAGCAGACTATTCCTCGAGGAATAGTCTGCTTGTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011546.2-486s21c1
Sequence:CCGGATAGAGGCTACAAGCGCTTTACTCGAGTAAAGCGCTTGTAGCCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011546
VALIDATED
ZEB1 MISSION shRNA shRNA Plasmid DNA
zinc finger E-box binding homeobox 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011546.1-1007s1c1
Sequence:CCGGCCTGTGGATTATGAGTTCAAACTCGAGTTTGAACTCATAATCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011546.1-770s1c1
Sequence:CCGGCCGAACTGCAAGAAACGGTTTCTCGAGAAACCGTTTCTTGCAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011546.1-1899s1c1
Sequence:CCGGCCGGGTCAGTAAACATACCTACTCGAGTAGGTATGTTTACTGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011546.1-2349s1c1
Sequence:CCGGCCATAAACATTGCTATTCCTACTCGAGTAGGAATAGCAATGTTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011546.1-2785s1c1
Sequence:CCGGGCATCATTTGATTGAGCACATCTCGAGATGTGCTCAATCAAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011546.2-355s21c1
Sequence:CCGGACAAGACACCGCCGTCATTTACTCGAGTAAATGACGGCGGTGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011546.2-2200s21c1
Sequence:CCGGGTCGACAGTCAGTAGCGTTTACTCGAGTAAACGCTACTGACTGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235852    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011546.2-3529s21c1
Sequence:CCGGGAACCTCAAACCTAGTAATTTCTCGAGAAATTACTAGGTTTGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011546.2-2442s21c1
Sequence:CCGGCCGCCAACAAGCAGACTATTCCTCGAGGAATAGTCTGCTTGTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011546.2-486s21c1
Sequence:CCGGATAGAGGCTACAAGCGCTTTACTCGAGTAAAGCGCTTGTAGCCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011546
VALIDATED
ZEB1 MISSION shRNA Lentiviral Transduction Particles
zinc finger E-box binding homeobox 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011546.1-1007s1c1
Sequence:CCGGCCTGTGGATTATGAGTTCAAACTCGAGTTTGAACTCATAATCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011546.1-770s1c1
Sequence:CCGGCCGAACTGCAAGAAACGGTTTCTCGAGAAACCGTTTCTTGCAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011546.1-1899s1c1
Sequence:CCGGCCGGGTCAGTAAACATACCTACTCGAGTAGGTATGTTTACTGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011546.1-2349s1c1
Sequence:CCGGCCATAAACATTGCTATTCCTACTCGAGTAGGAATAGCAATGTTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011546.1-2785s1c1
Sequence:CCGGGCATCATTTGATTGAGCACATCTCGAGATGTGCTCAATCAAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011546.2-355s21c1
Sequence:CCGGACAAGACACCGCCGTCATTTACTCGAGTAAATGACGGCGGTGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011546.2-2200s21c1
Sequence:CCGGGTCGACAGTCAGTAGCGTTTACTCGAGTAAACGCTACTGACTGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235852    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011546.2-3529s21c1
Sequence:CCGGGAACCTCAAACCTAGTAATTTCTCGAGAAATTACTAGGTTTGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011546.2-2442s21c1
Sequence:CCGGCCGCCAACAAGCAGACTATTCCTCGAGGAATAGTCTGCTTGTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011546.2-486s21c1
Sequence:CCGGATAGAGGCTACAAGCGCTTTACTCGAGTAAAGCGCTTGTAGCCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks