EMAIL THIS PAGE TO A FRIEND

ZEB2

zinc finger E-box binding homeobox 2

Synonyms: HSPC082 SIP-1 SIP1 SMADIP1 ZFHX1B
UniProtKB ID: O60315, A0JP09, B7Z2P2, F5H814, Q9UED1
Gene ID:
Human(9839) Summary: The protein encoded by this gene is a member of the Zfh1 family of 2-handed zinc finger/homeodomain proteins. It is located in the nucleus and functions as a DNA-binding transcriptional repressor that interacts with activated SMADs. Mutations in this gene are associated with Hirschsprung disease/Mowat-Wilson syndrome. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jan 2010]
Mouse(24136) zinc finger E-box binding homeobox 2
Rat(311071) zinc finger E-box binding homeobox 2
chicken(424306) zinc finger E-box binding homeobox 2
dog(483909) zinc finger E-box binding homeobox 2
Horse(100057772) zinc finger E-box binding homeobox 2
domestic cat(101082586) zinc finger E-box binding homeobox 2
domestic guinea pig(100727818) zinc finger E-box binding homeobox 2
naked mole-rat(101710481) zinc finger E-box binding homeobox 2
cow(338409) zinc finger E-box binding homeobox 2
sheep(101115193) zinc finger E-box binding homeobox 2
cow(539873) zinc finger E-box binding homeobox 2
341 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108744 Anti-ZEB2 affinity isolated antibody horse, pig, guinea pig, zebrafish, rat, mouse, human, horse
immunohistochemistry, western blot pricing
SAB2501679 Anti-ZEB2 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, mouse, canine, human
ELISA, western blot pricing
AV33694 Anti-ZEB2 antibody produced in rabbit affinity isolated antibody , mouse, rat, human, bovine, horse, rabbit, zebrafish, guinea pig
western blot pricing
SAB2102760 Anti-ZEB2 antibody produced in rabbit affinity isolated antibody mouse, guinea pig, horse, rat, rabbit, bovine, human
western blot pricing
HPA003456 Anti-ZEB2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2102999 Anti-ZEB2 antibody produced in rabbit affinity isolated antibody horse, zebrafish, human, bovine, guinea pig, mouse, rat
western blot pricing
SAB3500515 Anti-ZEB2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunocytochemistry, western blot pricing
SAB4503710 Anti-ZEB2, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
SAB1411870 ANTI-ZFHX1B antibody produced in mouse clone 2D12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411885 ANTI-ZFHX1B antibody produced in mouse clone 4G8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
WH0009839M1 Monoclonal Anti-ZFHX1B antibody produced in mouse clone 2D9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404760 Monoclonal Anti-ZFHX1B, (C-terminal) antibody produced in mouse clone 2H5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014795 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014795 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014795 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015753 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015753 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015753 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010131 MISSION® esiRNA esiRNA targeting human ZEB2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014795 Rosetta Predictions human pricing
NM_001033701 Rosetta Predictions rat pricing
NM_001033635 Rosetta Predictions mouse pricing
NM_015753 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014795 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114816 predicted 2154
2 SASI_Hs01_00114817 predicted 1620
3 SASI_Hs01_00114818 predicted 1249
4 SASI_Hs01_00114819 predicted 3465
5 SASI_Hs01_00114820 predicted 1750
6 SASI_Hs01_00114821 predicted 1882
7 SASI_Hs01_00114823 predicted 1276
8 SASI_Hs01_00114824 predicted 1560
9 SASI_Hs01_00114825 predicted 1718
10 SASI_Hs02_00346301 predicted 2913
11 SASI_Hs01_00114822 predicted 2208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033701 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044097 predicted 986
2 SASI_Rn01_00044098 predicted 2993
3 SASI_Rn02_00203739 predicted 2561
4 SASI_Rn02_00203740 predicted 1658
5 SASI_Rn02_00203741 predicted 3159
6 SASI_Rn01_00044101 predicted 794
7 SASI_Rn01_00044102 predicted 764
8 SASI_Rn01_00044103 predicted 1190
9 SASI_Rn01_00044105 predicted 1724
10 SASI_Rn01_00044106 predicted 1467
11 SASI_Rn01_00044099 predicted 1095
12 SASI_Rn01_00044100 predicted 1695
13 SASI_Rn01_00044104 predicted 1945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033635 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142869 predicted 1124
2 SASI_Mm01_00142870 predicted 1086
3 SASI_Mm01_00142871 predicted 959
4 SASI_Mm01_00142872 predicted 917
5 SASI_Mm01_00142873 predicted 684
6 SASI_Mm01_00142874 predicted 1075
7 SASI_Mm01_00142875 predicted 776
8 SASI_Mm01_00142876 predicted 591
9 SASI_Mm01_00142877 predicted 792
10 SASI_Mm01_00142878 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015753 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062546 predicted 3516
2 SASI_Mm02_00323082 predicted 2164
3 SASI_Mm01_00062548 predicted 2241
4 SASI_Mm02_00323083 predicted 2853
5 SASI_Mm02_00323084 predicted 3045
6 SASI_Mm01_00062550 predicted 1291
7 SASI_Mm01_00062551 predicted 1318
8 SASI_Mm01_00062552 predicted 1718
9 SASI_Mm02_00323085 predicted 1406
10 SASI_Mm01_00062554 predicted 3058
11 SASI_Mm01_00062545 predicted 2600
12 SASI_Mm01_00062547 predicted 2774
13 SASI_Mm01_00062549 predicted 1200
14 SASI_Mm01_00062553 predicted 1263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014795
VALIDATED
ZEB2 MISSION shRNA Bacterial Glycerol Stock
zinc finger E-box binding homeobox 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014795.3-2027s21c1
Sequence:CCGGGAGTTACTTCTCCTAATATTCCTCGAGGAATATTAGGAGAAGTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014795.3-4396s21c1
Sequence:CCGGGTGTGGTTCAGAGACTAATTCCTCGAGGAATTAGTCTCTGAACCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014795.3-4638s21c1
Sequence:CCGGCTGTACTTTCCTTTCGCTATTCTCGAGAATAGCGAAAGGAAAGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014795.3-894s21c1
Sequence:CCGGCACGATCCAGACCGCAATTAACTCGAGTTAATTGCGGTCTGGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014795.3-3306s21c1
Sequence:CCGGGATGAGCTTCCTACCACATATCTCGAGATATGTGGTAGGAAGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014795.2-4958s1c1
Sequence:CCGGGCAGTTCCTTAGTTTACATATCTCGAGATATGTAAACTAAGGAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014795.2-4006s1c1
Sequence:CCGGCCCGAAACGATACGAGATGAACTCGAGTTCATCTCGTATCGTTTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014795.2-1720s1c1
Sequence:CCGGCCCTTTATGAATGGTGGGCTTCTCGAGAAGCCCACCATTCATAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014795.2-2202s1c1
Sequence:CCGGCCACAACATATCCACTCCATTCTCGAGAATGGAGTGGATATGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014795.2-1831s1c1
Sequence:CCGGCCCACCATGAATAGTAATTTACTCGAGTAAATTACTATTCATGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014795
VALIDATED
ZEB2 MISSION shRNA shRNA Plasmid DNA
zinc finger E-box binding homeobox 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014795.3-2027s21c1
Sequence:CCGGGAGTTACTTCTCCTAATATTCCTCGAGGAATATTAGGAGAAGTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014795.3-4396s21c1
Sequence:CCGGGTGTGGTTCAGAGACTAATTCCTCGAGGAATTAGTCTCTGAACCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014795.3-4638s21c1
Sequence:CCGGCTGTACTTTCCTTTCGCTATTCTCGAGAATAGCGAAAGGAAAGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014795.3-894s21c1
Sequence:CCGGCACGATCCAGACCGCAATTAACTCGAGTTAATTGCGGTCTGGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014795.3-3306s21c1
Sequence:CCGGGATGAGCTTCCTACCACATATCTCGAGATATGTGGTAGGAAGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014795.2-4958s1c1
Sequence:CCGGGCAGTTCCTTAGTTTACATATCTCGAGATATGTAAACTAAGGAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014795.2-4006s1c1
Sequence:CCGGCCCGAAACGATACGAGATGAACTCGAGTTCATCTCGTATCGTTTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014795.2-1720s1c1
Sequence:CCGGCCCTTTATGAATGGTGGGCTTCTCGAGAAGCCCACCATTCATAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014795.2-2202s1c1
Sequence:CCGGCCACAACATATCCACTCCATTCTCGAGAATGGAGTGGATATGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014795.2-1831s1c1
Sequence:CCGGCCCACCATGAATAGTAATTTACTCGAGTAAATTACTATTCATGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014795
VALIDATED
ZEB2 MISSION shRNA Lentiviral Transduction Particles
zinc finger E-box binding homeobox 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014795.3-2027s21c1
Sequence:CCGGGAGTTACTTCTCCTAATATTCCTCGAGGAATATTAGGAGAAGTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014795.3-4396s21c1
Sequence:CCGGGTGTGGTTCAGAGACTAATTCCTCGAGGAATTAGTCTCTGAACCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014795.3-4638s21c1
Sequence:CCGGCTGTACTTTCCTTTCGCTATTCTCGAGAATAGCGAAAGGAAAGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014795.3-894s21c1
Sequence:CCGGCACGATCCAGACCGCAATTAACTCGAGTTAATTGCGGTCTGGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014795.3-3306s21c1
Sequence:CCGGGATGAGCTTCCTACCACATATCTCGAGATATGTGGTAGGAAGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014795.2-4958s1c1
Sequence:CCGGGCAGTTCCTTAGTTTACATATCTCGAGATATGTAAACTAAGGAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014795.2-4006s1c1
Sequence:CCGGCCCGAAACGATACGAGATGAACTCGAGTTCATCTCGTATCGTTTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014795.2-1720s1c1
Sequence:CCGGCCCTTTATGAATGGTGGGCTTCTCGAGAAGCCCACCATTCATAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014795.2-2202s1c1
Sequence:CCGGCCACAACATATCCACTCCATTCTCGAGAATGGAGTGGATATGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014795.2-1831s1c1
Sequence:CCGGCCCACCATGAATAGTAATTTACTCGAGTAAATTACTATTCATGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015753
VALIDATED
ZEB2 MISSION shRNA Bacterial Glycerol Stock
zinc finger E-box binding homeobox 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000226284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015753.3-1709s21c1
Sequence:CCGGCTAGACTTCAATGACTATAAACTCGAGTTTATAGTCATTGAAGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015753.3-2999s21c1
Sequence:GTACCGGAGAGAACCCAAAGGTATTATACTCGAGTATAATACCTTTGGGTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015753.3-7228s21c1
Sequence:GTACCGGATGCAATTTAGCCACTAATAGCTCGAGCTATTAGTGGCTAAATTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015753.3-3559s21c1
Sequence:CCGGCAGTTCCCTTCTGCGACATAACTCGAGTTATGTCGCAGAAGGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015753.3-1031s21c1
Sequence:CCGGCGAAGCGACACGGCCATTATTCTCGAGAATAATGGCCGTGTCGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015753.2-2313s1c1
Sequence:CCGGCCTCAGGAATTTGTGAAGGAACTCGAGTTCCTTCACAAATTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_015753.2-3344s1c1
Sequence:CCGGCCAGTGTCAGATTTGTAAGAACTCGAGTTCTTACAAATCTGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_015753.2-2924s1c1
Sequence:CCGGCCCATTTAGTGCCAAGCCTTTCTCGAGAAAGGCTTGGCACTAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_015753.2-1289s1c1
Sequence:CCGGCCGAATGAGAAACAATATCAACTCGAGTTGATATTGTTTCTCATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_015753.2-1443s1c1
Sequence:CCGGCCACTAGACTTCAATGACTATCTCGAGATAGTCATTGAAGTCTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015753
VALIDATED
ZEB2 MISSION shRNA shRNA Plasmid DNA
zinc finger E-box binding homeobox 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000226284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015753.3-1709s21c1
Sequence:CCGGCTAGACTTCAATGACTATAAACTCGAGTTTATAGTCATTGAAGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015753.3-2999s21c1
Sequence:GTACCGGAGAGAACCCAAAGGTATTATACTCGAGTATAATACCTTTGGGTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015753.3-7228s21c1
Sequence:GTACCGGATGCAATTTAGCCACTAATAGCTCGAGCTATTAGTGGCTAAATTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015753.3-3559s21c1
Sequence:CCGGCAGTTCCCTTCTGCGACATAACTCGAGTTATGTCGCAGAAGGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015753.3-1031s21c1
Sequence:CCGGCGAAGCGACACGGCCATTATTCTCGAGAATAATGGCCGTGTCGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015753.2-2313s1c1
Sequence:CCGGCCTCAGGAATTTGTGAAGGAACTCGAGTTCCTTCACAAATTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_015753.2-3344s1c1
Sequence:CCGGCCAGTGTCAGATTTGTAAGAACTCGAGTTCTTACAAATCTGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_015753.2-2924s1c1
Sequence:CCGGCCCATTTAGTGCCAAGCCTTTCTCGAGAAAGGCTTGGCACTAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_015753.2-1289s1c1
Sequence:CCGGCCGAATGAGAAACAATATCAACTCGAGTTGATATTGTTTCTCATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_015753.2-1443s1c1
Sequence:CCGGCCACTAGACTTCAATGACTATCTCGAGATAGTCATTGAAGTCTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015753
VALIDATED
ZEB2 MISSION shRNA Lentiviral Transduction Particles
zinc finger E-box binding homeobox 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000226284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015753.3-1709s21c1
Sequence:CCGGCTAGACTTCAATGACTATAAACTCGAGTTTATAGTCATTGAAGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015753.3-2999s21c1
Sequence:GTACCGGAGAGAACCCAAAGGTATTATACTCGAGTATAATACCTTTGGGTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015753.3-7228s21c1
Sequence:GTACCGGATGCAATTTAGCCACTAATAGCTCGAGCTATTAGTGGCTAAATTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015753.3-3559s21c1
Sequence:CCGGCAGTTCCCTTCTGCGACATAACTCGAGTTATGTCGCAGAAGGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015753.3-1031s21c1
Sequence:CCGGCGAAGCGACACGGCCATTATTCTCGAGAATAATGGCCGTGTCGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015753.2-2313s1c1
Sequence:CCGGCCTCAGGAATTTGTGAAGGAACTCGAGTTCCTTCACAAATTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_015753.2-3344s1c1
Sequence:CCGGCCAGTGTCAGATTTGTAAGAACTCGAGTTCTTACAAATCTGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_015753.2-2924s1c1
Sequence:CCGGCCCATTTAGTGCCAAGCCTTTCTCGAGAAAGGCTTGGCACTAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_015753.2-1289s1c1
Sequence:CCGGCCGAATGAGAAACAATATCAACTCGAGTTGATATTGTTTCTCATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_015753.2-1443s1c1
Sequence:CCGGCCACTAGACTTCAATGACTATCTCGAGATAGTCATTGAAGTCTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks