EMAIL THIS PAGE TO A FRIEND

ZER1

zyg-11 related, cell cycle regulator

Synonyms: C9orf60 ZYG ZYG11BL
UniProtKB ID: Q7Z7L7, O00156, Q5T272, Q5T273
Gene ID:
Human(10444) Summary: This gene encodes a subunit of an E3 ubiquitin ligase complex that may be involved in meiosis. The encoded protein contains three leucine-rich repeat motifs. [provided by RefSeq, Nov 2012]
Mouse(227693) zyg-11 related, cell cycle regulator
Rat(311842) zyg-11 related, cell cycle regulator
Zebrafish(405837) zer-1 homolog (C. elegans)
domestic cat(101082103) zer-1 homolog (C. elegans)
Horse(100066859) zer-1 homolog (C. elegans)
dog(491312) zer-1 homolog (C. elegans)
chicken(417205) zer-1 homolog (C. elegans)
cow(540351) zer-1 homolog (C. elegans)
sheep(101118428) zer-1 homolog (C. elegans)
naked mole-rat(101718211) zyg-11 related, cell cycle regulator
domestic guinea pig(100729084) zyg-11 related, cell cycle regulator
160 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006336 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006336 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006336 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178694 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178694 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178694 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006336 Rosetta Predictions human pricing
XM_001065175 Rosetta Predictions rat pricing
XM_001077108 Rosetta Predictions rat pricing
XM_001077126 Rosetta Predictions rat pricing
XM_242300 Rosetta Predictions rat pricing
NM_178694 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032639 predicted 2135
2 SASI_Hs01_00032640 predicted 1533
3 SASI_Hs01_00032641 predicted 2563
4 SASI_Hs01_00032642 predicted 1715
5 SASI_Hs01_00032643 predicted 2610
6 SASI_Hs01_00032644 predicted 964
7 SASI_Hs01_00032645 predicted 1996
8 SASI_Hs01_00032646 predicted 2458
9 SASI_Hs01_00032647 predicted 2438
10 SASI_Hs01_00032648 predicted 2541
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065175 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00313141 predicted 2271
2 SASI_Rn02_00313142 predicted 1488
3 SASI_Rn02_00313143 predicted 1036
4 SASI_Rn02_00313144 predicted 1598
5 SASI_Rn02_00313145 predicted 2585
6 SASI_Rn02_00313146 predicted 1379
7 SASI_Rn02_00313147 predicted 2598
8 SASI_Rn02_00313148 predicted 1051
9 SASI_Rn02_00313149 predicted 1353
10 SASI_Rn02_00313150 predicted 2514
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077108 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355814 predicted 2303
2 SASI_Rn02_00355815 predicted 1532
3 SASI_Rn02_00355816 predicted 1032
4 SASI_Rn02_00355817 predicted 1642
5 SASI_Rn02_00355818 predicted 2620
6 SASI_Rn02_00355819 predicted 1421
7 SASI_Rn02_00355820 predicted 2639
8 SASI_Rn02_00355821 predicted 1054
9 SASI_Rn02_00355822 predicted 1384
10 SASI_Rn02_00355823 predicted 2562
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077126 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355904 predicted 2264
2 SASI_Rn02_00355905 predicted 1490
3 SASI_Rn02_00355906 predicted 1036
4 SASI_Rn02_00355907 predicted 1596
5 SASI_Rn02_00355908 predicted 2577
6 SASI_Rn02_00355909 predicted 1375
7 SASI_Rn02_00355910 predicted 2594
8 SASI_Rn02_00355911 predicted 1051
9 SASI_Rn02_00355912 predicted 1347
10 SASI_Rn02_00355913 predicted 2518
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_242300 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391679 predicted 2305
2 SASI_Rn02_00391680 predicted 1533
3 SASI_Rn02_00391681 predicted 1039
4 SASI_Rn02_00391682 predicted 1640
5 SASI_Rn02_00391683 predicted 2623
6 SASI_Rn02_00391684 predicted 1418
7 SASI_Rn02_00391685 predicted 2639
8 SASI_Rn02_00391686 predicted 1054
9 SASI_Rn02_00391687 predicted 1387
10 SASI_Rn02_00391688 predicted 2558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178694 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057781 predicted 1425
2 SASI_Mm01_00057784 predicted 1998
3 SASI_Mm01_00057787 predicted 1299
4 SASI_Mm02_00349188 predicted 1250
5 SASI_Mm02_00349189 predicted 1283
6 SASI_Mm02_00349190 predicted 921
7 SASI_Mm01_00057789 predicted 2272
8 SASI_Mm01_00057790 predicted 1835
9 SASI_Mm02_00349191 predicted 2175
10 SASI_Mm02_00349192 predicted 1065
11 SASI_Mm01_00057782 predicted 1399
12 SASI_Mm01_00057783 predicted 1325
13 SASI_Mm01_00057785 predicted 2311
14 SASI_Mm01_00057786 predicted 2251
15 SASI_Mm01_00057788 predicted 2433
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006336
ZER1 MISSION shRNA Bacterial Glycerol Stock
zyg-11 related, cell cycle regulator
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006336.2-1682s1c1
Sequence:CCGGGCTCTCTTCTACCTAACAAATCTCGAGATTTGTTAGGTAGAAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006336.2-2195s1c1
Sequence:CCGGCATAGGAATATGCTAGGACTTCTCGAGAAGTCCTAGCATATTCCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006336.2-1465s1c1
Sequence:CCGGCTACAAAGTAAGTGGTGACAACTCGAGTTGTCACCACTTACTTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006336.2-1642s1c1
Sequence:CCGGCCACAAATATGACAGGAACATCTCGAGATGTTCCTGTCATATTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006336.2-1680s1c1
Sequence:CCGGCCGCTCTCTTCTACCTAACAACTCGAGTTGTTAGGTAGAAGAGAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006336.2-1999s1c1
Sequence:CCGGCTTTGTCGTGACCATGCTGAACTCGAGTTCAGCATGGTCACGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006336.2-757s1c1
Sequence:CCGGGTACCTGACTAACTGCGAGAACTCGAGTTCTCGCAGTTAGTCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006336.2-1270s1c1
Sequence:CCGGGAACCTAATGTCCCTGGACATCTCGAGATGTCCAGGGACATTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006336.2-2095s1c1
Sequence:CCGGCACAGATGAAACTCCTGACAACTCGAGTTGTCAGGAGTTTCATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006336.2-2128s1c1
Sequence:CCGGCCTCAATTTCAACGGCATGAACTCGAGTTCATGCCGTTGAAATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006336.2-925s1c1
Sequence:CCGGGCTGGTTAAGGATTTCACCTTCTCGAGAAGGTGAAATCCTTAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006336
ZER1 MISSION shRNA shRNA Plasmid DNA
zyg-11 related, cell cycle regulator
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006336.2-1682s1c1
Sequence:CCGGGCTCTCTTCTACCTAACAAATCTCGAGATTTGTTAGGTAGAAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006336.2-2195s1c1
Sequence:CCGGCATAGGAATATGCTAGGACTTCTCGAGAAGTCCTAGCATATTCCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006336.2-1465s1c1
Sequence:CCGGCTACAAAGTAAGTGGTGACAACTCGAGTTGTCACCACTTACTTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006336.2-1642s1c1
Sequence:CCGGCCACAAATATGACAGGAACATCTCGAGATGTTCCTGTCATATTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006336.2-1680s1c1
Sequence:CCGGCCGCTCTCTTCTACCTAACAACTCGAGTTGTTAGGTAGAAGAGAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006336.2-1999s1c1
Sequence:CCGGCTTTGTCGTGACCATGCTGAACTCGAGTTCAGCATGGTCACGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006336.2-757s1c1
Sequence:CCGGGTACCTGACTAACTGCGAGAACTCGAGTTCTCGCAGTTAGTCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006336.2-1270s1c1
Sequence:CCGGGAACCTAATGTCCCTGGACATCTCGAGATGTCCAGGGACATTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006336.2-2095s1c1
Sequence:CCGGCACAGATGAAACTCCTGACAACTCGAGTTGTCAGGAGTTTCATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006336.2-2128s1c1
Sequence:CCGGCCTCAATTTCAACGGCATGAACTCGAGTTCATGCCGTTGAAATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006336.2-925s1c1
Sequence:CCGGGCTGGTTAAGGATTTCACCTTCTCGAGAAGGTGAAATCCTTAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006336
ZER1 MISSION shRNA Lentiviral Transduction Particles
zyg-11 related, cell cycle regulator
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006336.2-1682s1c1
Sequence:CCGGGCTCTCTTCTACCTAACAAATCTCGAGATTTGTTAGGTAGAAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006336.2-2195s1c1
Sequence:CCGGCATAGGAATATGCTAGGACTTCTCGAGAAGTCCTAGCATATTCCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006336.2-1465s1c1
Sequence:CCGGCTACAAAGTAAGTGGTGACAACTCGAGTTGTCACCACTTACTTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006336.2-1642s1c1
Sequence:CCGGCCACAAATATGACAGGAACATCTCGAGATGTTCCTGTCATATTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006336.2-1680s1c1
Sequence:CCGGCCGCTCTCTTCTACCTAACAACTCGAGTTGTTAGGTAGAAGAGAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006336.2-1999s1c1
Sequence:CCGGCTTTGTCGTGACCATGCTGAACTCGAGTTCAGCATGGTCACGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006336.2-757s1c1
Sequence:CCGGGTACCTGACTAACTGCGAGAACTCGAGTTCTCGCAGTTAGTCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006336.2-1270s1c1
Sequence:CCGGGAACCTAATGTCCCTGGACATCTCGAGATGTCCAGGGACATTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006336.2-2095s1c1
Sequence:CCGGCACAGATGAAACTCCTGACAACTCGAGTTGTCAGGAGTTTCATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006336.2-2128s1c1
Sequence:CCGGCCTCAATTTCAACGGCATGAACTCGAGTTCATGCCGTTGAAATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006336.2-925s1c1
Sequence:CCGGGCTGGTTAAGGATTTCACCTTCTCGAGAAGGTGAAATCCTTAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178694
ZER1 MISSION shRNA Bacterial Glycerol Stock
zyg-11 related, cell cycle regulator
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178694.3-2707s1c1
Sequence:CCGGCGACGCATTTCCTTAATGTTACTCGAGTAACATTAAGGAAATGCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178694.3-3742s1c1
Sequence:CCGGCCATGCACATAAGCAGGCTTTCTCGAGAAAGCCTGCTTATGTGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178694.3-2171s1c1
Sequence:CCGGCGACGGCATTGAGGTTTCTTACTCGAGTAAGAAACCTCAATGCCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178694.3-2456s1c1
Sequence:CCGGGCTGATTAAAGAAGGTGGGATCTCGAGATCCCACCTTCTTTAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178694.3-1273s21c1
Sequence:CCGGTGCAGTTCCTTGGGCTCTTTGCTCGAGCAAAGAGCCCAAGGAACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178694.3-447s21c1
Sequence:CCGGTTTGAGCCACACGAGACTTTCCTCGAGGAAAGTCTCGTGTGGCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178694.3-1495s21c1
Sequence:CCGGCCCTCAAGTGTCACAAGTATGCTCGAGCATACTTGTGACACTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178694.3-1295s21c1
Sequence:CCGGGACCTCATTGTGTCGTCTTACCTCGAGGTAAGACGACACAATGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178694
ZER1 MISSION shRNA shRNA Plasmid DNA
zyg-11 related, cell cycle regulator
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178694.3-2707s1c1
Sequence:CCGGCGACGCATTTCCTTAATGTTACTCGAGTAACATTAAGGAAATGCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178694.3-3742s1c1
Sequence:CCGGCCATGCACATAAGCAGGCTTTCTCGAGAAAGCCTGCTTATGTGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178694.3-2171s1c1
Sequence:CCGGCGACGGCATTGAGGTTTCTTACTCGAGTAAGAAACCTCAATGCCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178694.3-2456s1c1
Sequence:CCGGGCTGATTAAAGAAGGTGGGATCTCGAGATCCCACCTTCTTTAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178694.3-1273s21c1
Sequence:CCGGTGCAGTTCCTTGGGCTCTTTGCTCGAGCAAAGAGCCCAAGGAACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178694.3-447s21c1
Sequence:CCGGTTTGAGCCACACGAGACTTTCCTCGAGGAAAGTCTCGTGTGGCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178694.3-1495s21c1
Sequence:CCGGCCCTCAAGTGTCACAAGTATGCTCGAGCATACTTGTGACACTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178694.3-1295s21c1
Sequence:CCGGGACCTCATTGTGTCGTCTTACCTCGAGGTAAGACGACACAATGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178694
ZER1 MISSION shRNA Lentiviral Transduction Particles
zyg-11 related, cell cycle regulator
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178694.3-2707s1c1
Sequence:CCGGCGACGCATTTCCTTAATGTTACTCGAGTAACATTAAGGAAATGCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178694.3-3742s1c1
Sequence:CCGGCCATGCACATAAGCAGGCTTTCTCGAGAAAGCCTGCTTATGTGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178694.3-2171s1c1
Sequence:CCGGCGACGGCATTGAGGTTTCTTACTCGAGTAAGAAACCTCAATGCCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178694.3-2456s1c1
Sequence:CCGGGCTGATTAAAGAAGGTGGGATCTCGAGATCCCACCTTCTTTAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178694.3-1273s21c1
Sequence:CCGGTGCAGTTCCTTGGGCTCTTTGCTCGAGCAAAGAGCCCAAGGAACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178694.3-447s21c1
Sequence:CCGGTTTGAGCCACACGAGACTTTCCTCGAGGAAAGTCTCGTGTGGCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178694.3-1495s21c1
Sequence:CCGGCCCTCAAGTGTCACAAGTATGCTCGAGCATACTTGTGACACTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178694.3-1295s21c1
Sequence:CCGGGACCTCATTGTGTCGTCTTACCTCGAGGTAAGACGACACAATGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks