EMAIL THIS PAGE TO A FRIEND

ZFAND1

zinc finger, AN1-type domain 1

UniProtKB ID: Q8TCF1, E5RIG0, Q658R7, Q6IA32, Q6PGQ6, Q9H810
Gene ID:
Mouse(66361) zinc finger, AN1-type domain 1
Rat(361917) zinc finger, AN1-type domain 1
sheep(101115631) zinc finger, AN1-type domain 1
domestic guinea pig(100723335) zinc finger, AN1-type domain 1
naked mole-rat(101705479) zinc finger, AN1-type domain 1
Zebrafish(445257) zinc finger, AN1-type domain 1
dog(487018) zinc finger, AN1-type domain 1
domestic cat(101088645) zinc finger, AN1-type domain 1
chicken(420200) zinc finger, AN1-type domain 1
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025512 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025512 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025512 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024699 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024699 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024699 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024699 Rosetta Predictions human pricing
XM_001055634 Rosetta Predictions rat pricing
XM_342213 Rosetta Predictions rat pricing
NM_025512 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024699 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357157 predicted 430
2 SASI_Hs01_00131327 predicted 594
3 SASI_Hs01_00131328 predicted 763
4 SASI_Hs01_00131329 predicted 292
5 SASI_Hs01_00131330 predicted 222
6 SASI_Hs01_00131332 predicted 489
7 SASI_Hs01_00131333 predicted 361
8 SASI_Hs01_00131335 predicted 797
9 SASI_Hs01_00131336 predicted 822
10 SASI_Hs02_00357158 predicted 343
11 SASI_Hs01_00131331 predicted 445
12 SASI_Hs01_00131334 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055634 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280409 predicted 422
2 SASI_Rn02_00280410 predicted 932
3 SASI_Rn02_00280411 predicted 745
4 SASI_Rn02_00280412 predicted 1071
5 SASI_Rn02_00280413 predicted 324
6 SASI_Rn02_00280414 predicted 1044
7 SASI_Rn02_00280415 predicted 967
8 SASI_Rn02_00280416 predicted 253
9 SASI_Rn02_00280417 predicted 264
10 SASI_Rn02_00280418 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342213 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393926 predicted 1548
2 SASI_Rn02_00393927 predicted 1537
3 SASI_Rn02_00393928 predicted 1500
4 SASI_Rn02_00393929 predicted 1433
5 SASI_Rn02_00393930 predicted 1487
6 SASI_Rn02_00393931 predicted 1387
7 SASI_Rn02_00393932 predicted 420
8 SASI_Rn02_00393933 predicted 933
9 SASI_Rn02_00393934 predicted 745
10 SASI_Rn02_00393935 predicted 1068
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025512 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150414 predicted 489
2 SASI_Mm01_00150416 predicted 277
3 SASI_Mm01_00150417 predicted 1243
4 SASI_Mm02_00328400 predicted 425
5 SASI_Mm01_00150418 predicted 221
6 SASI_Mm01_00150419 predicted 431
7 SASI_Mm01_00150420 predicted 322
8 SASI_Mm01_00150421 predicted 241
9 SASI_Mm01_00150422 predicted 321
10 SASI_Mm01_00150423 predicted 1249
11 SASI_Mm01_00150415 predicted 1278
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025512
VALIDATED
ZFAND1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, AN1-type domain 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_025512.2-79s1c1
Sequence:CCGGGTGATGGTTGTTCAGGAATATCTCGAGATATTCCTGAACAACCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_025512.2-677s1c1
Sequence:CCGGCCTGCCATTGGATCACACATTCTCGAGAATGTGTGATCCAATGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025512.2-589s21c1
Sequence:CCGGTTGCAGCTTCTCTCGCTAATCCTCGAGGATTAGCGAGAGAAGCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025512.2-1417s21c1
Sequence:CCGGCCTAAGAAGGGAACGTAATTTCTCGAGAAATTACGTTCCCTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_025512.2-1020s1c1
Sequence:CCGGGACAATTACTGGCGAAGTATTCTCGAGAATACTTCGCCAGTAATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_025512.2-747s1c1
Sequence:CCGGGTTATCTTGGAATATCTTAACCTCGAGGTTAAGATATTCCAAGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_025512.2-792s1c1
Sequence:CCGGGTTGACTCTTACTTGGAATAGCTCGAGCTATTCCAAGTAAGAGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025512.2-432s21c1
Sequence:CCGGGTGGCGCTGATGAAGCTAAAGCTCGAGCTTTAGCTTCATCAGCGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025512.2-273s21c1
Sequence:CCGGCACCGTCATCAGTCGGATCATCTCGAGATGATCCGACTGATGACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025512.2-711s21c1
Sequence:CCGGACGAAGGAGGAGTGCCCTTTACTCGAGTAAAGGGCACTCCTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025512
VALIDATED
ZFAND1 MISSION shRNA shRNA Plasmid DNA
zinc finger, AN1-type domain 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_025512.2-79s1c1
Sequence:CCGGGTGATGGTTGTTCAGGAATATCTCGAGATATTCCTGAACAACCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_025512.2-677s1c1
Sequence:CCGGCCTGCCATTGGATCACACATTCTCGAGAATGTGTGATCCAATGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025512.2-589s21c1
Sequence:CCGGTTGCAGCTTCTCTCGCTAATCCTCGAGGATTAGCGAGAGAAGCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025512.2-1417s21c1
Sequence:CCGGCCTAAGAAGGGAACGTAATTTCTCGAGAAATTACGTTCCCTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_025512.2-1020s1c1
Sequence:CCGGGACAATTACTGGCGAAGTATTCTCGAGAATACTTCGCCAGTAATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_025512.2-747s1c1
Sequence:CCGGGTTATCTTGGAATATCTTAACCTCGAGGTTAAGATATTCCAAGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_025512.2-792s1c1
Sequence:CCGGGTTGACTCTTACTTGGAATAGCTCGAGCTATTCCAAGTAAGAGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025512.2-432s21c1
Sequence:CCGGGTGGCGCTGATGAAGCTAAAGCTCGAGCTTTAGCTTCATCAGCGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025512.2-273s21c1
Sequence:CCGGCACCGTCATCAGTCGGATCATCTCGAGATGATCCGACTGATGACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025512.2-711s21c1
Sequence:CCGGACGAAGGAGGAGTGCCCTTTACTCGAGTAAAGGGCACTCCTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025512
VALIDATED
ZFAND1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, AN1-type domain 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_025512.2-79s1c1
Sequence:CCGGGTGATGGTTGTTCAGGAATATCTCGAGATATTCCTGAACAACCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_025512.2-677s1c1
Sequence:CCGGCCTGCCATTGGATCACACATTCTCGAGAATGTGTGATCCAATGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025512.2-589s21c1
Sequence:CCGGTTGCAGCTTCTCTCGCTAATCCTCGAGGATTAGCGAGAGAAGCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025512.2-1417s21c1
Sequence:CCGGCCTAAGAAGGGAACGTAATTTCTCGAGAAATTACGTTCCCTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_025512.2-1020s1c1
Sequence:CCGGGACAATTACTGGCGAAGTATTCTCGAGAATACTTCGCCAGTAATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_025512.2-747s1c1
Sequence:CCGGGTTATCTTGGAATATCTTAACCTCGAGGTTAAGATATTCCAAGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_025512.2-792s1c1
Sequence:CCGGGTTGACTCTTACTTGGAATAGCTCGAGCTATTCCAAGTAAGAGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025512.2-432s21c1
Sequence:CCGGGTGGCGCTGATGAAGCTAAAGCTCGAGCTTTAGCTTCATCAGCGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025512.2-273s21c1
Sequence:CCGGCACCGTCATCAGTCGGATCATCTCGAGATGATCCGACTGATGACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025512.2-711s21c1
Sequence:CCGGACGAAGGAGGAGTGCCCTTTACTCGAGTAAAGGGCACTCCTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024699
VALIDATED
ZFAND1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, AN1-type domain 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_024699.1-475s1c1
Sequence:CCGGGCGATAAGTCATTACCACAGACTCGAGTCTGTGGTAATGACTTATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024699.1-1006s1c1
Sequence:CCGGCGGATCCTCAATTATTAGCAACTCGAGTTGCTAATAATTGAGGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_024699.1-172s1c1
Sequence:CCGGGACTGAAGACAGATCAACATACTCGAGTATGTTGATCTGTCTTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_024699.1-721s1c1
Sequence:CCGGCTAAGGAGGATTGTCCTTTATCTCGAGATAAAGGACAATCCTCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_024699.1-686s1c1
Sequence:CCGGCTTACCCTTGGATCATACTTTCTCGAGAAAGTATGATCCAAGGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149036    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024699.1-1200s1c1
Sequence:CCGGGCAGAGAGAGAAAGAGATGAACTCGAGTTCATCTCTTTCTCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024699.1-685s1c1
Sequence:CCGGCCTTACCCTTGGATCATACTTCTCGAGAAGTATGATCCAAGGGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024699.1-720s1c1
Sequence:CCGGGCTAAGGAGGATTGTCCTTTACTCGAGTAAAGGACAATCCTCCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024699.1-721s21c1
Sequence:CCGGCTAAGGAGGATTGTCCTTTATCTCGAGATAAAGGACAATCCTCCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024699.1-475s21c1
Sequence:CCGGGCGATAAGTCATTACCACAGACTCGAGTCTGTGGTAATGACTTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024699.1-807s1c1
Sequence:CCGGTCTTACTTGGAATAGTCATTCCTCGAGGAATGACTATTCCAAGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024699.1-229s1c1
Sequence:CCGGGAGAACTTGTGGCAGTTATATCTCGAGATATAACTGCCACAAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024699.1-1200s21c1
Sequence:CCGGGCAGAGAGAGAAAGAGATGAACTCGAGTTCATCTCTTTCTCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024699.1-172s21c1
Sequence:CCGGGACTGAAGACAGATCAACATACTCGAGTATGTTGATCTGTCTTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024699
VALIDATED
ZFAND1 MISSION shRNA shRNA Plasmid DNA
zinc finger, AN1-type domain 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_024699.1-475s1c1
Sequence:CCGGGCGATAAGTCATTACCACAGACTCGAGTCTGTGGTAATGACTTATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024699.1-1006s1c1
Sequence:CCGGCGGATCCTCAATTATTAGCAACTCGAGTTGCTAATAATTGAGGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_024699.1-172s1c1
Sequence:CCGGGACTGAAGACAGATCAACATACTCGAGTATGTTGATCTGTCTTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_024699.1-721s1c1
Sequence:CCGGCTAAGGAGGATTGTCCTTTATCTCGAGATAAAGGACAATCCTCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_024699.1-686s1c1
Sequence:CCGGCTTACCCTTGGATCATACTTTCTCGAGAAAGTATGATCCAAGGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149036    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024699.1-1200s1c1
Sequence:CCGGGCAGAGAGAGAAAGAGATGAACTCGAGTTCATCTCTTTCTCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024699.1-685s1c1
Sequence:CCGGCCTTACCCTTGGATCATACTTCTCGAGAAGTATGATCCAAGGGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024699.1-720s1c1
Sequence:CCGGGCTAAGGAGGATTGTCCTTTACTCGAGTAAAGGACAATCCTCCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024699.1-721s21c1
Sequence:CCGGCTAAGGAGGATTGTCCTTTATCTCGAGATAAAGGACAATCCTCCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024699.1-475s21c1
Sequence:CCGGGCGATAAGTCATTACCACAGACTCGAGTCTGTGGTAATGACTTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024699.1-807s1c1
Sequence:CCGGTCTTACTTGGAATAGTCATTCCTCGAGGAATGACTATTCCAAGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024699.1-229s1c1
Sequence:CCGGGAGAACTTGTGGCAGTTATATCTCGAGATATAACTGCCACAAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024699.1-1200s21c1
Sequence:CCGGGCAGAGAGAGAAAGAGATGAACTCGAGTTCATCTCTTTCTCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024699.1-172s21c1
Sequence:CCGGGACTGAAGACAGATCAACATACTCGAGTATGTTGATCTGTCTTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024699
VALIDATED
ZFAND1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, AN1-type domain 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_024699.1-475s1c1
Sequence:CCGGGCGATAAGTCATTACCACAGACTCGAGTCTGTGGTAATGACTTATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024699.1-1006s1c1
Sequence:CCGGCGGATCCTCAATTATTAGCAACTCGAGTTGCTAATAATTGAGGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_024699.1-172s1c1
Sequence:CCGGGACTGAAGACAGATCAACATACTCGAGTATGTTGATCTGTCTTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_024699.1-721s1c1
Sequence:CCGGCTAAGGAGGATTGTCCTTTATCTCGAGATAAAGGACAATCCTCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_024699.1-686s1c1
Sequence:CCGGCTTACCCTTGGATCATACTTTCTCGAGAAAGTATGATCCAAGGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149036    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024699.1-1200s1c1
Sequence:CCGGGCAGAGAGAGAAAGAGATGAACTCGAGTTCATCTCTTTCTCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024699.1-685s1c1
Sequence:CCGGCCTTACCCTTGGATCATACTTCTCGAGAAGTATGATCCAAGGGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024699.1-720s1c1
Sequence:CCGGGCTAAGGAGGATTGTCCTTTACTCGAGTAAAGGACAATCCTCCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024699.1-721s21c1
Sequence:CCGGCTAAGGAGGATTGTCCTTTATCTCGAGATAAAGGACAATCCTCCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024699.1-475s21c1
Sequence:CCGGGCGATAAGTCATTACCACAGACTCGAGTCTGTGGTAATGACTTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024699.1-807s1c1
Sequence:CCGGTCTTACTTGGAATAGTCATTCCTCGAGGAATGACTATTCCAAGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024699.1-229s1c1
Sequence:CCGGGAGAACTTGTGGCAGTTATATCTCGAGATATAACTGCCACAAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024699.1-1200s21c1
Sequence:CCGGGCAGAGAGAGAAAGAGATGAACTCGAGTTCATCTCTTTCTCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024699.1-172s21c1
Sequence:CCGGGACTGAAGACAGATCAACATACTCGAGTATGTTGATCTGTCTTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks