EMAIL THIS PAGE TO A FRIEND

ZFAND2B

zinc finger, AN1-type domain 2B

Synonyms: AIRAPL
UniProtKB ID: Q8WV99, Q8NB98
Gene ID:
Human(130617) Summary: This gene encodes a protein containing AN1-type zinc-fingers and ubiquitin-interacting motifs. The encoded protein likely associates with the proteosome to stimulate the degradation of toxic or misfolded proteins. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]
Mouse(68818) zinc finger, AN1 type domain 2B
Rat(363253) zinc finger, AN1 type domain 2B
cow(508203) zinc finger, AN1-type domain 2B
sheep(101114680) zinc finger, AN1-type domain 2B
domestic guinea pig(100735890) zinc finger, AN1-type domain 2B
naked mole-rat(101723559) zinc finger, AN1-type domain 2B
domestic cat(101094283) zinc finger, AN1-type domain 2B
dog(610602) zinc finger, AN1-type domain 2B
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138802 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138802 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138802 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026846 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026846 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026846 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138802 Rosetta Predictions human pricing
NM_001025745 Rosetta Predictions rat pricing
NM_026846 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126015 predicted 517
2 SASI_Hs01_00126016 predicted 526
3 SASI_Hs01_00126017 predicted 622
4 SASI_Hs01_00126018 predicted 693
5 SASI_Hs01_00126019 predicted 399
6 SASI_Hs01_00126020 predicted 817
7 SASI_Hs01_00126021 predicted 831
8 SASI_Hs02_00363956 predicted 545
9 SASI_Hs02_00363957 predicted 325
10 SASI_Hs02_00363958 predicted 660
11 SASI_Hs01_00126014 predicted 739
12 SASI_Hs01_00126022 predicted 491
13 SASI_Hs01_00126023 predicted 967
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025745 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068227 predicted 353
2 SASI_Rn01_00068228 predicted 352
3 SASI_Rn01_00068229 predicted 813
4 SASI_Rn02_00203394 predicted 438
5 SASI_Rn01_00068230 predicted 744
6 SASI_Rn01_00068231 predicted 645
7 SASI_Rn01_00068234 predicted 545
8 SASI_Rn02_00203395 predicted 359
9 SASI_Rn01_00068235 predicted 1005
10 SASI_Rn01_00068236 predicted 744
11 SASI_Rn01_00068232 predicted 517
12 SASI_Rn01_00068233 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026846 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114141 predicted 353
2 SASI_Mm01_00114143 predicted 539
3 SASI_Mm01_00114144 predicted 906
4 SASI_Mm01_00114145 predicted 539
5 SASI_Mm01_00114146 predicted 330
6 SASI_Mm01_00114148 predicted 553
7 SASI_Mm01_00114149 predicted 936
8 SASI_Mm01_00114150 predicted 388
9 SASI_Mm02_00331048 predicted 455
10 SASI_Mm02_00331049 predicted 798
11 SASI_Mm01_00114142 predicted 269
12 SASI_Mm01_00114147 predicted 268
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138802
VALIDATED
ZFAND2B MISSION shRNA Bacterial Glycerol Stock
zinc finger, AN1-type domain 2B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138802.1-739s1c1
Sequence:CCGGGATTGCTTTGCAGAATGGCCTCTCGAGAGGCCATTCTGCAAAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138802.1-847s1c1
Sequence:CCGGCCTAGCTTTAGCACAAGCACTCTCGAGAGTGCTTGTGCTAAAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138802.1-663s1c1
Sequence:CCGGCAAGTCAAACCATGCCTTCCTCTCGAGAGGAAGGCATGGTTTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138802.1-994s21c1
Sequence:CCGGTCACACCTCTAGGGTACACAGCTCGAGCTGTGTACCCTAGAGGTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138802.1-552s21c1
Sequence:CCGGGGCATCCACTGGACCATGATTCTCGAGAATCATGGTCCAGTGGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138802.1-448s1c1
Sequence:CCGGACGTAAGATCTTCACCAATAACTCGAGTTATTGGTGAAGATCTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219777    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138802.1-1120s1c1
Sequence:CCGGAGAGAGCGGCTAGCAACTGTTCTCGAGAACAGTTGCTAGCCGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138802.1-517s21c1
Sequence:CCGGTGAACGCTGTAGCCGAAACTTCTCGAGAAGTTTCGGCTACAGCGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138802.1-296s21c1
Sequence:CCGGCATCACTGTGGATCTGCTTACCTCGAGGTAAGCAGATCCACAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138802
VALIDATED
ZFAND2B MISSION shRNA shRNA Plasmid DNA
zinc finger, AN1-type domain 2B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138802.1-739s1c1
Sequence:CCGGGATTGCTTTGCAGAATGGCCTCTCGAGAGGCCATTCTGCAAAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138802.1-847s1c1
Sequence:CCGGCCTAGCTTTAGCACAAGCACTCTCGAGAGTGCTTGTGCTAAAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138802.1-663s1c1
Sequence:CCGGCAAGTCAAACCATGCCTTCCTCTCGAGAGGAAGGCATGGTTTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138802.1-994s21c1
Sequence:CCGGTCACACCTCTAGGGTACACAGCTCGAGCTGTGTACCCTAGAGGTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138802.1-552s21c1
Sequence:CCGGGGCATCCACTGGACCATGATTCTCGAGAATCATGGTCCAGTGGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138802.1-448s1c1
Sequence:CCGGACGTAAGATCTTCACCAATAACTCGAGTTATTGGTGAAGATCTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219777    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138802.1-1120s1c1
Sequence:CCGGAGAGAGCGGCTAGCAACTGTTCTCGAGAACAGTTGCTAGCCGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138802.1-517s21c1
Sequence:CCGGTGAACGCTGTAGCCGAAACTTCTCGAGAAGTTTCGGCTACAGCGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138802.1-296s21c1
Sequence:CCGGCATCACTGTGGATCTGCTTACCTCGAGGTAAGCAGATCCACAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138802
VALIDATED
ZFAND2B MISSION shRNA Lentiviral Transduction Particles
zinc finger, AN1-type domain 2B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138802.1-739s1c1
Sequence:CCGGGATTGCTTTGCAGAATGGCCTCTCGAGAGGCCATTCTGCAAAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138802.1-847s1c1
Sequence:CCGGCCTAGCTTTAGCACAAGCACTCTCGAGAGTGCTTGTGCTAAAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138802.1-663s1c1
Sequence:CCGGCAAGTCAAACCATGCCTTCCTCTCGAGAGGAAGGCATGGTTTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138802.1-994s21c1
Sequence:CCGGTCACACCTCTAGGGTACACAGCTCGAGCTGTGTACCCTAGAGGTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138802.1-552s21c1
Sequence:CCGGGGCATCCACTGGACCATGATTCTCGAGAATCATGGTCCAGTGGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138802.1-448s1c1
Sequence:CCGGACGTAAGATCTTCACCAATAACTCGAGTTATTGGTGAAGATCTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219777    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138802.1-1120s1c1
Sequence:CCGGAGAGAGCGGCTAGCAACTGTTCTCGAGAACAGTTGCTAGCCGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138802.1-517s21c1
Sequence:CCGGTGAACGCTGTAGCCGAAACTTCTCGAGAAGTTTCGGCTACAGCGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138802.1-296s21c1
Sequence:CCGGCATCACTGTGGATCTGCTTACCTCGAGGTAAGCAGATCCACAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026846
VALIDATED
ZFAND2B MISSION shRNA Bacterial Glycerol Stock
zinc finger, AN1-type domain 2B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026846.1-339s1c1
Sequence:CCGGGAGCACATTGACAGAGACTGTCTCGAGACAGTCTCTGTCAATGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026846.1-1025s1c1
Sequence:CCGGGAAGGACACTCATGCAGCTAACTCGAGTTAGCTGCATGAGTGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026846.1-429s1c1
Sequence:CCGGCGGGAGATGATGAAACTGACTCTCGAGAGTCAGTTTCATCATCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026846.1-756s1c1
Sequence:CCGGGTTCTAAGTTCTCAGGAGGAACTCGAGTTCCTCCTGAGAACTTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026846.2-338s21c1
Sequence:CCGGGAGCACATTGACAGAGACTGTCTCGAGACAGTCTCTGTCAATGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026846.2-755s21c1
Sequence:CCGGGTTCTAAGTTCTCAGGAGGAACTCGAGTTCCTCCTGAGAACTTAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026846.2-1024s21c1
Sequence:CCGGGAAGGACACTCATGCAGCTAACTCGAGTTAGCTGCATGAGTGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026846.2-428s21c1
Sequence:CCGGCGGGAGATGATGAAACTGACTCTCGAGAGTCAGTTTCATCATCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026846
VALIDATED
ZFAND2B MISSION shRNA shRNA Plasmid DNA
zinc finger, AN1-type domain 2B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026846.1-339s1c1
Sequence:CCGGGAGCACATTGACAGAGACTGTCTCGAGACAGTCTCTGTCAATGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026846.1-1025s1c1
Sequence:CCGGGAAGGACACTCATGCAGCTAACTCGAGTTAGCTGCATGAGTGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026846.1-429s1c1
Sequence:CCGGCGGGAGATGATGAAACTGACTCTCGAGAGTCAGTTTCATCATCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026846.1-756s1c1
Sequence:CCGGGTTCTAAGTTCTCAGGAGGAACTCGAGTTCCTCCTGAGAACTTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026846.2-338s21c1
Sequence:CCGGGAGCACATTGACAGAGACTGTCTCGAGACAGTCTCTGTCAATGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026846.2-755s21c1
Sequence:CCGGGTTCTAAGTTCTCAGGAGGAACTCGAGTTCCTCCTGAGAACTTAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026846.2-1024s21c1
Sequence:CCGGGAAGGACACTCATGCAGCTAACTCGAGTTAGCTGCATGAGTGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026846.2-428s21c1
Sequence:CCGGCGGGAGATGATGAAACTGACTCTCGAGAGTCAGTTTCATCATCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026846
VALIDATED
ZFAND2B MISSION shRNA Lentiviral Transduction Particles
zinc finger, AN1-type domain 2B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026846.1-339s1c1
Sequence:CCGGGAGCACATTGACAGAGACTGTCTCGAGACAGTCTCTGTCAATGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026846.1-1025s1c1
Sequence:CCGGGAAGGACACTCATGCAGCTAACTCGAGTTAGCTGCATGAGTGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026846.1-429s1c1
Sequence:CCGGCGGGAGATGATGAAACTGACTCTCGAGAGTCAGTTTCATCATCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026846.1-756s1c1
Sequence:CCGGGTTCTAAGTTCTCAGGAGGAACTCGAGTTCCTCCTGAGAACTTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026846.2-338s21c1
Sequence:CCGGGAGCACATTGACAGAGACTGTCTCGAGACAGTCTCTGTCAATGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026846.2-755s21c1
Sequence:CCGGGTTCTAAGTTCTCAGGAGGAACTCGAGTTCCTCCTGAGAACTTAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026846.2-1024s21c1
Sequence:CCGGGAAGGACACTCATGCAGCTAACTCGAGTTAGCTGCATGAGTGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026846.2-428s21c1
Sequence:CCGGCGGGAGATGATGAAACTGACTCTCGAGAGTCAGTTTCATCATCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks