EMAIL THIS PAGE TO A FRIEND

ZFAND3

zinc finger, AN1-type domain 3

Synonyms: TEX27
UniProtKB ID: Q9H8U3, Q5SZZ0, Q5SZZ1
Gene ID:
Mouse(21769) zinc finger, AN1-type domain 3
Rat(361816) zinc finger, AN1-type domain 3
Zebrafish(563496) zinc finger, AN1-type domain 3
dog(481776) zinc finger, AN1-type domain 3
domestic cat(101095014) zinc finger, AN1-type domain 3
chicken(421430) zinc finger, AN1-type domain 3
naked mole-rat(101701476) zinc finger, AN1-type domain 3
domestic guinea pig(100726217) zinc finger, AN1-type domain 3
cow(532641) zinc finger, AN1-type domain 3
sheep(101104940) zinc finger, AN1-type domain 3
113 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021943 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021943 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021943 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_148926 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_148926 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_148926 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021943 Rosetta Predictions human pricing
NM_001012175 Rosetta Predictions rat pricing
XM_574725 Rosetta Predictions rat pricing
NM_148926 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216087 predicted 461
2 SASI_Hs01_00216088 predicted 513
3 SASI_Hs01_00216089 predicted 599
4 SASI_Hs02_00355261 predicted 519
5 SASI_Hs01_00216090 predicted 403
6 SASI_Hs01_00216091 predicted 351
7 SASI_Hs02_00355262 predicted 655
8 SASI_Hs01_00216092 predicted 597
9 SASI_Hs01_00216093 predicted 703
10 SASI_Hs01_00216095 predicted 302
11 SASI_Hs01_00216094 predicted 614
12 SASI_Hs01_00216096 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012175 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200376 predicted 844
2 SASI_Rn01_00103969 predicted 682
3 SASI_Rn01_00103971 predicted 328
4 SASI_Rn01_00103972 predicted 831
5 SASI_Rn01_00103973 predicted 1004
6 SASI_Rn01_00103974 predicted 378
7 SASI_Rn01_00103975 predicted 624
8 SASI_Rn01_00103976 predicted 1049
9 SASI_Rn01_00103978 predicted 407
10 SASI_Rn02_00200377 predicted 504
11 SASI_Rn01_00103970 predicted 440
12 SASI_Rn01_00103977 predicted 1186
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574725 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00156065 predicted 1110
2 SASI_Rn01_00156066 predicted 849
3 SASI_Rn01_00156067 predicted 1245
4 SASI_Rn01_00156068 predicted 1421
5 SASI_Rn01_00156069 predicted 1625
6 SASI_Rn01_00156070 predicted 1045
7 SASI_Rn01_00156071 predicted 1476
8 SASI_Rn01_00156072 predicted 1591
9 SASI_Rn01_00156073 predicted 822
10 SASI_Rn01_00156074 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148926 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156053 predicted 1086
2 SASI_Mm02_00342725 predicted 423
3 SASI_Mm01_00156056 predicted 1173
4 SASI_Mm01_00156057 predicted 416
5 SASI_Mm01_00156058 predicted 1165
6 SASI_Mm01_00156059 predicted 597
7 SASI_Mm01_00156060 predicted 1014
8 SASI_Mm01_00156061 predicted 465
9 SASI_Mm01_00156062 predicted 590
10 SASI_Mm02_00342726 predicted 429
11 SASI_Mm01_00156054 predicted 879
12 SASI_Mm01_00156055 predicted 800
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021943
VALIDATED
ZFAND3 MISSION shRNA Bacterial Glycerol Stock
zinc finger, AN1-type domain 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021943.2-846s21c1
Sequence:CCGGAGGAAACCAGTCGATCTAAACCTCGAGGTTTAGATCGACTGGTTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021943.2-727s21c1
Sequence:CCGGCACAGCTCATGTCTCATTAATCTCGAGATTAATGAGACATGAGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021943.2-1037s21c1
Sequence:CCGGATGGTGAAGCTGGACCGGAAACTCGAGTTTCCGGTCCAGCTTCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_021943.x-288s1c1
Sequence:CCGGGACAACAACAATACCTCGATACTCGAGTATCGAGGTATTGTTGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_021943.x-617s1c1
Sequence:CCGGCGGTTATGTGTTCTGTATGTTCTCGAGAACATACAGAACACATAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021943.x-486s1c1
Sequence:CCGGCGGCCACGACTACTTGAGAATCTCGAGATTCTCAAGTAGTCGTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_021943.x-492s1c1
Sequence:CCGGCGACTACTTGAGAATACGGAACTCGAGTTCCGTATTCTCAAGTAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021943.x-1835s1c1
Sequence:CCGGCCAGTCCACATCTACCATATACTCGAGTATATGGTAGATGTGGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021943
VALIDATED
ZFAND3 MISSION shRNA shRNA Plasmid DNA
zinc finger, AN1-type domain 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021943.2-846s21c1
Sequence:CCGGAGGAAACCAGTCGATCTAAACCTCGAGGTTTAGATCGACTGGTTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021943.2-727s21c1
Sequence:CCGGCACAGCTCATGTCTCATTAATCTCGAGATTAATGAGACATGAGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021943.2-1037s21c1
Sequence:CCGGATGGTGAAGCTGGACCGGAAACTCGAGTTTCCGGTCCAGCTTCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_021943.x-288s1c1
Sequence:CCGGGACAACAACAATACCTCGATACTCGAGTATCGAGGTATTGTTGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_021943.x-617s1c1
Sequence:CCGGCGGTTATGTGTTCTGTATGTTCTCGAGAACATACAGAACACATAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021943.x-486s1c1
Sequence:CCGGCGGCCACGACTACTTGAGAATCTCGAGATTCTCAAGTAGTCGTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_021943.x-492s1c1
Sequence:CCGGCGACTACTTGAGAATACGGAACTCGAGTTCCGTATTCTCAAGTAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021943.x-1835s1c1
Sequence:CCGGCCAGTCCACATCTACCATATACTCGAGTATATGGTAGATGTGGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021943
VALIDATED
ZFAND3 MISSION shRNA Lentiviral Transduction Particles
zinc finger, AN1-type domain 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021943.2-846s21c1
Sequence:CCGGAGGAAACCAGTCGATCTAAACCTCGAGGTTTAGATCGACTGGTTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021943.2-727s21c1
Sequence:CCGGCACAGCTCATGTCTCATTAATCTCGAGATTAATGAGACATGAGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021943.2-1037s21c1
Sequence:CCGGATGGTGAAGCTGGACCGGAAACTCGAGTTTCCGGTCCAGCTTCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_021943.x-288s1c1
Sequence:CCGGGACAACAACAATACCTCGATACTCGAGTATCGAGGTATTGTTGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_021943.x-617s1c1
Sequence:CCGGCGGTTATGTGTTCTGTATGTTCTCGAGAACATACAGAACACATAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021943.x-486s1c1
Sequence:CCGGCGGCCACGACTACTTGAGAATCTCGAGATTCTCAAGTAGTCGTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_021943.x-492s1c1
Sequence:CCGGCGACTACTTGAGAATACGGAACTCGAGTTCCGTATTCTCAAGTAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021943.x-1835s1c1
Sequence:CCGGCCAGTCCACATCTACCATATACTCGAGTATATGGTAGATGTGGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148926
ZFAND3 MISSION shRNA Bacterial Glycerol Stock
zinc finger, AN1-type domain 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148926.2-300s1c1
Sequence:CCGGCAAGTACAAGTAACAGCCAATCTCGAGATTGGCTGTTACTTGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148926.2-233s1c1
Sequence:CCGGACTATGAATCTCTGTTCCAAACTCGAGTTTGGAACAGAGATTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148926.2-794s1c1
Sequence:CCGGCGCTGTTCTTAGTTCACTAATCTCGAGATTAGTGAACTAAGAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148926.2-655s1c1
Sequence:CCGGCGACTGTACGTTCGACCACATCTCGAGATGTGGTCGAACGTACAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148926.2-417s1c1
Sequence:CCGGTGAATGTAACTTCACCGAGTACTCGAGTACTCGGTGAAGTTACATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148926
ZFAND3 MISSION shRNA shRNA Plasmid DNA
zinc finger, AN1-type domain 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148926.2-300s1c1
Sequence:CCGGCAAGTACAAGTAACAGCCAATCTCGAGATTGGCTGTTACTTGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148926.2-233s1c1
Sequence:CCGGACTATGAATCTCTGTTCCAAACTCGAGTTTGGAACAGAGATTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148926.2-794s1c1
Sequence:CCGGCGCTGTTCTTAGTTCACTAATCTCGAGATTAGTGAACTAAGAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148926.2-655s1c1
Sequence:CCGGCGACTGTACGTTCGACCACATCTCGAGATGTGGTCGAACGTACAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148926.2-417s1c1
Sequence:CCGGTGAATGTAACTTCACCGAGTACTCGAGTACTCGGTGAAGTTACATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148926
ZFAND3 MISSION shRNA Lentiviral Transduction Particles
zinc finger, AN1-type domain 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148926.2-300s1c1
Sequence:CCGGCAAGTACAAGTAACAGCCAATCTCGAGATTGGCTGTTACTTGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148926.2-233s1c1
Sequence:CCGGACTATGAATCTCTGTTCCAAACTCGAGTTTGGAACAGAGATTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148926.2-794s1c1
Sequence:CCGGCGCTGTTCTTAGTTCACTAATCTCGAGATTAGTGAACTAAGAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148926.2-655s1c1
Sequence:CCGGCGACTGTACGTTCGACCACATCTCGAGATGTGGTCGAACGTACAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148926.2-417s1c1
Sequence:CCGGTGAATGTAACTTCACCGAGTACTCGAGTACTCGGTGAAGTTACATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks