EMAIL THIS PAGE TO A FRIEND

ZFAND4

zinc finger, AN1-type domain 4

Synonyms: ANUBL1
UniProtKB ID: Q86XD8, A8K8V4, B2RAX2, Q5VVY5
Gene ID:
Mouse(67492) zinc finger, AN1-type domain 4
Rat(286998) zinc finger, AN1-type domain 4
cow(514391) zinc finger, AN1-type domain 4
sheep(101119875) zinc finger, AN1-type domain 4
domestic guinea pig(100717811) zinc finger, AN1-type domain 4
naked mole-rat(101704137) zinc finger, AN1-type domain 4
Zebrafish(100148477) zinc finger, AN1-type domain 4
chicken(423771) zinc finger, AN1-type domain 4
dog(477752) zinc finger, AN1-type domain 4
135 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174890 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174890 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174890 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081317 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081317 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081317 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128324 Rosetta Predictions human pricing
NM_174890 Rosetta Predictions human pricing
NM_173332 Rosetta Predictions rat pricing
NM_001081317 Rosetta Predictions mouse pricing
XM_892874 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128324 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331086 predicted 307
2 SASI_Hs02_00331087 predicted 1103
3 SASI_Hs02_00331088 predicted 802
4 SASI_Hs02_00331089 predicted 1652
5 SASI_Hs02_00331090 predicted 1907
6 SASI_Hs02_00331091 predicted 604
7 SASI_Hs02_00331092 predicted 2168
8 SASI_Hs02_00331093 predicted 2375
9 SASI_Hs02_00331094 predicted 1687
10 SASI_Hs02_00331095 predicted 1519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022772 predicted 282
2 SASI_Hs01_00022773 predicted 1076
3 SASI_Hs01_00022774 predicted 777
4 SASI_Hs01_00022775 predicted 1880
5 SASI_Hs01_00022776 predicted 574
6 SASI_Hs02_00368758 predicted 2141
7 SASI_Hs01_00022777 predicted 1659
8 SASI_Hs01_00022778 predicted 2352
9 SASI_Hs01_00022780 predicted 1617
10 SASI_Hs02_00368759 predicted 1493
11 SASI_Hs01_00022771 predicted 1549
12 SASI_Hs01_00022779 predicted 2431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173332 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269455 predicted 542
2 SASI_Rn02_00269456 predicted 321
3 SASI_Rn02_00269457 predicted 310
4 SASI_Rn02_00269458 predicted 267
5 SASI_Rn02_00269459 predicted 1767
6 SASI_Rn02_00269460 predicted 1117
7 SASI_Rn02_00269461 predicted 625
8 SASI_Rn02_00269462 predicted 1878
9 SASI_Rn02_00269463 predicted 403
10 SASI_Rn02_00269464 predicted 1741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081317 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297231 predicted 998
2 SASI_Mm02_00297232 predicted 377
3 SASI_Mm02_00297233 predicted 1994
4 SASI_Mm02_00297234 predicted 1296
5 SASI_Mm02_00297235 predicted 360
6 SASI_Mm02_00297236 predicted 322
7 SASI_Mm02_00297237 predicted 1862
8 SASI_Mm02_00297238 predicted 629
9 SASI_Mm02_00297239 predicted 844
10 SASI_Mm02_00297240 predicted 2091
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_892874 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279808 predicted 996
2 SASI_Mm01_00279809 predicted 598
3 SASI_Mm01_00279810 predicted 388
4 SASI_Mm01_00279811 predicted 1992
5 SASI_Mm01_00279812 predicted 366
6 SASI_Mm01_00279813 predicted 328
7 SASI_Mm01_00279814 predicted 1864
8 SASI_Mm01_00279815 predicted 638
9 SASI_Mm01_00279816 predicted 843
10 SASI_Mm01_00279817 predicted 2095
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174890
ZFAND4 MISSION shRNA Bacterial Glycerol Stock
zinc finger, AN1-type domain 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174890.1-3010s1c1
Sequence:CCGGCGGACATGAATCCATTCTATACTCGAGTATAGAATGGATTCATGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174890.1-1338s1c1
Sequence:CCGGGCCATCTAGTAATGGGAACATCTCGAGATGTTCCCATTACTAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174890.1-1893s1c1
Sequence:CCGGGCCTGTTGGTTGTGTAAATAACTCGAGTTATTTACACAACCAACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174890.1-521s1c1
Sequence:CCGGGCGGACCTATAAATACTAGAACTCGAGTTCTAGTATTTATAGGTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174890.1-1599s1c1
Sequence:CCGGCCGGGAATTAAGTCCTCACAACTCGAGTTGTGAGGACTTAATTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174890.2-2241s21c1
Sequence:CCGGACTTGCTTTCAAGGTGTTAAACTCGAGTTTAACACCTTGAAAGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174890.2-1001s21c1
Sequence:CCGGTCCTACAGACGATCCACTTAGCTCGAGCTAAGTGGATCGTCTGTAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174890
ZFAND4 MISSION shRNA shRNA Plasmid DNA
zinc finger, AN1-type domain 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174890.1-3010s1c1
Sequence:CCGGCGGACATGAATCCATTCTATACTCGAGTATAGAATGGATTCATGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174890.1-1338s1c1
Sequence:CCGGGCCATCTAGTAATGGGAACATCTCGAGATGTTCCCATTACTAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174890.1-1893s1c1
Sequence:CCGGGCCTGTTGGTTGTGTAAATAACTCGAGTTATTTACACAACCAACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174890.1-521s1c1
Sequence:CCGGGCGGACCTATAAATACTAGAACTCGAGTTCTAGTATTTATAGGTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174890.1-1599s1c1
Sequence:CCGGCCGGGAATTAAGTCCTCACAACTCGAGTTGTGAGGACTTAATTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174890.2-2241s21c1
Sequence:CCGGACTTGCTTTCAAGGTGTTAAACTCGAGTTTAACACCTTGAAAGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174890.2-1001s21c1
Sequence:CCGGTCCTACAGACGATCCACTTAGCTCGAGCTAAGTGGATCGTCTGTAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174890
ZFAND4 MISSION shRNA Lentiviral Transduction Particles
zinc finger, AN1-type domain 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174890.1-3010s1c1
Sequence:CCGGCGGACATGAATCCATTCTATACTCGAGTATAGAATGGATTCATGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174890.1-1338s1c1
Sequence:CCGGGCCATCTAGTAATGGGAACATCTCGAGATGTTCCCATTACTAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174890.1-1893s1c1
Sequence:CCGGGCCTGTTGGTTGTGTAAATAACTCGAGTTATTTACACAACCAACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174890.1-521s1c1
Sequence:CCGGGCGGACCTATAAATACTAGAACTCGAGTTCTAGTATTTATAGGTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174890.1-1599s1c1
Sequence:CCGGCCGGGAATTAAGTCCTCACAACTCGAGTTGTGAGGACTTAATTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174890.2-2241s21c1
Sequence:CCGGACTTGCTTTCAAGGTGTTAAACTCGAGTTTAACACCTTGAAAGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174890.2-1001s21c1
Sequence:CCGGTCCTACAGACGATCCACTTAGCTCGAGCTAAGTGGATCGTCTGTAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081317
ZFAND4 MISSION shRNA Bacterial Glycerol Stock
zinc finger, AN1-type domain 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081317.1-1149s21c1
Sequence:CCGGGATGACAATTGGGAGATTAACCTCGAGGTTAATCTCCCAATTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081317.1-1000s21c1
Sequence:CCGGTAAGAGTCCTCCCTCATATTGCTCGAGCAATATGAGGGAGGACTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081317.1-147s21c1
Sequence:CCGGATACAGTTGCATACAACATATCTCGAGATATGTTGTATGCAACTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081317.1-1204s21c1
Sequence:CCGGTTCCTCAGTTGACCCATATAGCTCGAGCTATATGGGTCAACTGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081317.1-491s21c1
Sequence:CCGGTATGCGTGGTGGACCGATAAGCTCGAGCTTATCGGTCCACCACGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081317
ZFAND4 MISSION shRNA shRNA Plasmid DNA
zinc finger, AN1-type domain 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081317.1-1149s21c1
Sequence:CCGGGATGACAATTGGGAGATTAACCTCGAGGTTAATCTCCCAATTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081317.1-1000s21c1
Sequence:CCGGTAAGAGTCCTCCCTCATATTGCTCGAGCAATATGAGGGAGGACTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081317.1-147s21c1
Sequence:CCGGATACAGTTGCATACAACATATCTCGAGATATGTTGTATGCAACTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081317.1-1204s21c1
Sequence:CCGGTTCCTCAGTTGACCCATATAGCTCGAGCTATATGGGTCAACTGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081317.1-491s21c1
Sequence:CCGGTATGCGTGGTGGACCGATAAGCTCGAGCTTATCGGTCCACCACGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081317
ZFAND4 MISSION shRNA Lentiviral Transduction Particles
zinc finger, AN1-type domain 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081317.1-1149s21c1
Sequence:CCGGGATGACAATTGGGAGATTAACCTCGAGGTTAATCTCCCAATTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081317.1-1000s21c1
Sequence:CCGGTAAGAGTCCTCCCTCATATTGCTCGAGCAATATGAGGGAGGACTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081317.1-147s21c1
Sequence:CCGGATACAGTTGCATACAACATATCTCGAGATATGTTGTATGCAACTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081317.1-1204s21c1
Sequence:CCGGTTCCTCAGTTGACCCATATAGCTCGAGCTATATGGGTCAACTGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081317.1-491s21c1
Sequence:CCGGTATGCGTGGTGGACCGATAAGCTCGAGCTTATCGGTCCACCACGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks