EMAIL THIS PAGE TO A FRIEND

ZFAND5

zinc finger, AN1-type domain 5

Synonyms: ZA20D2 ZFAND5A ZNF216
UniProtKB ID: O76080, A8K484
Gene ID:
Mouse(22682) zinc finger, AN1-type domain 5
Rat(293960) zinc finger, AN1-type domain 5
chicken(427254) zinc finger, AN1-type domain 5
dog(476324) zinc finger, AN1-type domain 5
domestic cat(101090146) zinc finger, AN1-type domain 5
domestic guinea pig(100728253) zinc finger, AN1-type domain 5
cow(404110) zinc finger, AN1-type domain 5
sheep(100302558) zinc finger, AN1-type domain 5
181 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA018129 Anti-ZFAND5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2102763 Anti-ZFAND5 antibody produced in rabbit affinity isolated antibody bovine, guinea pig, sheep, canine, human, horse, rabbit, pig, mouse, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009551 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009551 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009551 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006007 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006007 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006007 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102420 Rosetta Predictions human pricing
NM_001102421 Rosetta Predictions human pricing
NM_006007 Rosetta Predictions human pricing
NM_001106356 Rosetta Predictions rat pricing
NM_009551 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323123 predicted 1008
2 SASI_Hs02_00323124 predicted 1233
3 SASI_Hs02_00323125 predicted 902
4 SASI_Hs02_00323126 predicted 1124
5 SASI_Hs02_00323127 predicted 1297
6 SASI_Hs02_00323128 predicted 1325
7 SASI_Hs02_00323129 predicted 1474
8 SASI_Hs02_00323130 predicted 1519
9 SASI_Hs02_00323131 predicted 905
10 SASI_Hs02_00323132 predicted 1144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323133 predicted 868
2 SASI_Hs02_00323134 predicted 1093
3 SASI_Hs02_00323135 predicted 768
4 SASI_Hs02_00323136 predicted 987
5 SASI_Hs02_00323137 predicted 1163
6 SASI_Hs02_00323138 predicted 1186
7 SASI_Hs02_00323139 predicted 1342
8 SASI_Hs02_00323140 predicted 1379
9 SASI_Hs02_00323141 predicted 772
10 SASI_Hs02_00323142 predicted 1008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006007 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340713 predicted 870
2 SASI_Hs01_00033506 predicted 1090
3 SASI_Hs01_00033514 predicted 759
4 SASI_Hs02_00340714 predicted 982
5 SASI_Hs01_00033515 predicted 1153
6 SASI_Hs01_00033509 predicted 1180
7 SASI_Hs02_00340715 predicted 1341
8 SASI_Hs02_00340716 predicted 1379
9 SASI_Hs02_00340717 predicted 765
10 SASI_Hs02_00340718 predicted 1006
11 SASI_Hs01_00033507 predicted 374
12 SASI_Hs01_00033508 predicted 370
13 SASI_Hs01_00033510 predicted 924
14 SASI_Hs01_00033511 predicted 939
15 SASI_Hs01_00033512 predicted 769
16 SASI_Hs01_00033513 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106356 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218168 predicted 1177
2 SASI_Rn02_00218169 predicted 702
3 SASI_Rn02_00218170 predicted 832
4 SASI_Rn02_00218171 predicted 1303
5 SASI_Rn02_00218172 predicted 1391
6 SASI_Rn02_00218173 predicted 1173
7 SASI_Rn02_00218174 predicted 937
8 SASI_Rn02_00218175 predicted 1529
9 SASI_Rn02_00218176 predicted 1370
10 SASI_Rn02_00218177 predicted 1318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009551 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057451 predicted 1006
2 SASI_Mm01_00057452 predicted 677
3 SASI_Mm01_00057453 predicted 1237
4 SASI_Mm01_00057454 predicted 1022
5 SASI_Mm01_00057455 predicted 649
6 SASI_Mm01_00057456 predicted 1269
7 SASI_Mm01_00057457 predicted 591
8 SASI_Mm01_00057458 predicted 995
9 SASI_Mm01_00057459 predicted 1025
10 SASI_Mm02_00316398 predicted 557
11 SASI_Mm01_00057460 predicted 1130
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009551
VALIDATED
ZFAND5 MISSION shRNA Bacterial Glycerol Stock
zinc finger, AN1-type domain 5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009551.4-535s21c1
Sequence:CCGGTATGGGAATCCTAGGACAAATCTCGAGATTTGTCCTAGGATTCCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216471    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009551.4-1455s1c1
Sequence:CCGGGGAATGTAATCAAGGTATAATCTCGAGATTATACCTTGATTACATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009551.4-756s21c1
Sequence:CCGGCTTGCCTGTAACTCAACAAATCTCGAGATTTGTTGAGTTACAGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240691    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009551.4-1455s21c1
Sequence:CCGGGGAATGTAATCAAGGTATAATCTCGAGATTATACCTTGATTACATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009551.4-560s21c1
Sequence:CCGGTGTGTTCTGTTTGCTACAAAGCTCGAGCTTTGTAGCAAACAGAACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009551.4-675s21c1
Sequence:CCGGGAGAGCAGATGCTGGTTTAAACTCGAGTTTAAACCAGCATCTGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009551.2-1027s1c1
Sequence:CCGGCAACTGTCCATATGATTACAACTCGAGTTGTAATCATATGGACAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009551
VALIDATED
ZFAND5 MISSION shRNA shRNA Plasmid DNA
zinc finger, AN1-type domain 5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009551.4-535s21c1
Sequence:CCGGTATGGGAATCCTAGGACAAATCTCGAGATTTGTCCTAGGATTCCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216471    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009551.4-1455s1c1
Sequence:CCGGGGAATGTAATCAAGGTATAATCTCGAGATTATACCTTGATTACATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009551.4-756s21c1
Sequence:CCGGCTTGCCTGTAACTCAACAAATCTCGAGATTTGTTGAGTTACAGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240691    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009551.4-1455s21c1
Sequence:CCGGGGAATGTAATCAAGGTATAATCTCGAGATTATACCTTGATTACATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009551.4-560s21c1
Sequence:CCGGTGTGTTCTGTTTGCTACAAAGCTCGAGCTTTGTAGCAAACAGAACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009551.4-675s21c1
Sequence:CCGGGAGAGCAGATGCTGGTTTAAACTCGAGTTTAAACCAGCATCTGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009551.2-1027s1c1
Sequence:CCGGCAACTGTCCATATGATTACAACTCGAGTTGTAATCATATGGACAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009551
VALIDATED
ZFAND5 MISSION shRNA Lentiviral Transduction Particles
zinc finger, AN1-type domain 5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009551.4-535s21c1
Sequence:CCGGTATGGGAATCCTAGGACAAATCTCGAGATTTGTCCTAGGATTCCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216471    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009551.4-1455s1c1
Sequence:CCGGGGAATGTAATCAAGGTATAATCTCGAGATTATACCTTGATTACATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009551.4-756s21c1
Sequence:CCGGCTTGCCTGTAACTCAACAAATCTCGAGATTTGTTGAGTTACAGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240691    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009551.4-1455s21c1
Sequence:CCGGGGAATGTAATCAAGGTATAATCTCGAGATTATACCTTGATTACATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009551.4-560s21c1
Sequence:CCGGTGTGTTCTGTTTGCTACAAAGCTCGAGCTTTGTAGCAAACAGAACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009551.4-675s21c1
Sequence:CCGGGAGAGCAGATGCTGGTTTAAACTCGAGTTTAAACCAGCATCTGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009551.2-1027s1c1
Sequence:CCGGCAACTGTCCATATGATTACAACTCGAGTTGTAATCATATGGACAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006007
VALIDATED
ZFAND5 MISSION shRNA Bacterial Glycerol Stock
zinc finger, AN1-type domain 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006007.1-600s1c1
Sequence:CCGGGAGCATTTCAAGAGAGGACAACTCGAGTTGTCCTCTCTTGAAATGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_006007.1-1377s1c1
Sequence:CCGGCCCTCTTTAATTTCACAACATCTCGAGATGTTGTGAAATTAAAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006007.1-822s1c1
Sequence:CCGGCCGTTACTCTGACAAGCACAACTCGAGTTGTGCTTGTCAGAGTAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006007.1-570s1c1
Sequence:CCGGCTTGCCTGTAACTCAGCAAATCTCGAGATTTGCTGAGTTACAGGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006007.1-758s1c1
Sequence:CCGGGCAGAAAGAAAGTTGGTCTTACTCGAGTAAGACCAACTTTCTTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006007
VALIDATED
ZFAND5 MISSION shRNA shRNA Plasmid DNA
zinc finger, AN1-type domain 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006007.1-600s1c1
Sequence:CCGGGAGCATTTCAAGAGAGGACAACTCGAGTTGTCCTCTCTTGAAATGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_006007.1-1377s1c1
Sequence:CCGGCCCTCTTTAATTTCACAACATCTCGAGATGTTGTGAAATTAAAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006007.1-822s1c1
Sequence:CCGGCCGTTACTCTGACAAGCACAACTCGAGTTGTGCTTGTCAGAGTAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006007.1-570s1c1
Sequence:CCGGCTTGCCTGTAACTCAGCAAATCTCGAGATTTGCTGAGTTACAGGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006007.1-758s1c1
Sequence:CCGGGCAGAAAGAAAGTTGGTCTTACTCGAGTAAGACCAACTTTCTTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006007
VALIDATED
ZFAND5 MISSION shRNA Lentiviral Transduction Particles
zinc finger, AN1-type domain 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006007.1-600s1c1
Sequence:CCGGGAGCATTTCAAGAGAGGACAACTCGAGTTGTCCTCTCTTGAAATGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_006007.1-1377s1c1
Sequence:CCGGCCCTCTTTAATTTCACAACATCTCGAGATGTTGTGAAATTAAAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006007.1-822s1c1
Sequence:CCGGCCGTTACTCTGACAAGCACAACTCGAGTTGTGCTTGTCAGAGTAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006007.1-570s1c1
Sequence:CCGGCTTGCCTGTAACTCAGCAAATCTCGAGATTTGCTGAGTTACAGGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006007.1-758s1c1
Sequence:CCGGGCAGAAAGAAAGTTGGTCTTACTCGAGTAAGACCAACTTTCTTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks