EMAIL THIS PAGE TO A FRIEND

ZFAND6

zinc finger, AN1-type domain 6

Synonyms: AWP1 ZA20D3 ZFAND5B
UniProtKB ID: Q6FIF0, D3DW92, D3DW94, O95792, Q9BQF7, Q9GZY3
Gene ID:
Mouse(65098) zinc finger, AN1-type domain 6
Rat(293067) zinc finger, AN1-type domain 6
Zebrafish(336461) zinc finger, AN1-type domain 6
dog(479064) zinc finger, AN1-type domain 6
domestic cat(101086725) zinc finger, AN1-type domain 6
chicken(415483) zinc finger, AN1-type domain 6
cow(514167) zinc finger, AN1-type domain 6
sheep(101114817) zinc finger, AN1-type domain 6
domestic guinea pig(100733268) zinc finger, AN1-type domain 6
naked mole-rat(101703287) zinc finger, AN1-type domain 6
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW22410F Anti-ZA20D3 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
AV34464 Anti-ZA20D3 antibody produced in rabbit IgG fraction of antiserum bovine, guinea pig, rat, canine, horse, rabbit, human, mouse
immunohistochemistry, western blot pricing
SAB2104151 Anti-ZFAND6 antibody produced in rabbit affinity isolated antibody human, pig, rabbit, canine, zebrafish, horse, bovine, guinea pig, mouse, rat
western blot pricing
HPA034845 Anti-ZFAND6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022985 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022985 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022985 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019006 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019006 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019006 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019006 Rosetta Predictions human pricing
NM_001007630 Rosetta Predictions rat pricing
NM_022985 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206294 predicted 465
2 SASI_Hs01_00206295 predicted 462
3 SASI_Hs01_00206296 predicted 466
4 SASI_Hs01_00206297 predicted 347
5 SASI_Hs01_00206298 predicted 635
6 SASI_Hs01_00206299 predicted 634
7 SASI_Hs01_00206300 predicted 455
8 SASI_Hs01_00206301 predicted 841
9 SASI_Hs01_00206302 predicted 788
10 SASI_Hs01_00206303 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007630 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058660 predicted 332
2 SASI_Rn02_00198736 predicted 335
3 SASI_Rn01_00058661 predicted 325
4 SASI_Rn01_00058662 predicted 330
5 SASI_Rn01_00058663 predicted 1108
6 SASI_Rn01_00058664 predicted 333
7 SASI_Rn01_00058665 predicted 323
8 SASI_Rn01_00058666 predicted 1106
9 SASI_Rn01_00058667 predicted 311
10 SASI_Rn01_00058668 predicted 322
11 SASI_Rn01_00058669 predicted 1051
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022985 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158593 predicted 302
2 SASI_Mm01_00158594 predicted 453
3 SASI_Mm01_00158595 predicted 240
4 SASI_Mm01_00158596 predicted 345
5 SASI_Mm01_00158597 predicted 297
6 SASI_Mm01_00158598 predicted 298
7 SASI_Mm01_00158599 predicted 450
8 SASI_Mm01_00158600 predicted 332
9 SASI_Mm01_00158601 predicted 450
10 SASI_Mm01_00158602 predicted 254
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022985
VALIDATED
ZFAND6 MISSION shRNA Bacterial Glycerol Stock
zinc finger, AN1-type domain 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_022985.3-999s1c1
Sequence:CCGGCCCTTGAATCATGCATGTCATCTCGAGATGACATGCATGATTCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_022985.3-486s1c1
Sequence:CCGGCCTGTGTCAAATCAGTCACTTCTCGAGAAGTGACTGATTTGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_022985.3-1208s1c1
Sequence:CCGGGCGTTGATCTTGCAGTTTATTCTCGAGAATAAACTGCAAGATCAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022985.6-305s21c1
Sequence:CCGGATGTGTTCAGTATGCTATAAACTCGAGTTTATAGCATACTGAACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022985.6-281s21c1
Sequence:CCGGTATGGAAACCCTCGTACAAATCTCGAGATTTGTACGAGGGTTTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_022985.6-455s1c1
Sequence:CCGGGATTCTACGTCTTCATCTATGCTCGAGCATAGATGAAGACGTAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022985.6-346s21c1
Sequence:CCGGCAGTAGCAATGGTAGAATAAGCTCGAGCTTATTCTACCATTGCTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022985.6-1394s21c1
Sequence:CCGGTTTCTTTGCACCCACTATTTACTCGAGTAAATAGTGGGTGCAAAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022985.6-787s21c1
Sequence:CCGGTTACTCAGATGTTCACAATTGCTCGAGCAATTGTGAACATCTGAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022985
VALIDATED
ZFAND6 MISSION shRNA shRNA Plasmid DNA
zinc finger, AN1-type domain 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_022985.3-999s1c1
Sequence:CCGGCCCTTGAATCATGCATGTCATCTCGAGATGACATGCATGATTCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_022985.3-486s1c1
Sequence:CCGGCCTGTGTCAAATCAGTCACTTCTCGAGAAGTGACTGATTTGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_022985.3-1208s1c1
Sequence:CCGGGCGTTGATCTTGCAGTTTATTCTCGAGAATAAACTGCAAGATCAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022985.6-305s21c1
Sequence:CCGGATGTGTTCAGTATGCTATAAACTCGAGTTTATAGCATACTGAACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022985.6-281s21c1
Sequence:CCGGTATGGAAACCCTCGTACAAATCTCGAGATTTGTACGAGGGTTTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_022985.6-455s1c1
Sequence:CCGGGATTCTACGTCTTCATCTATGCTCGAGCATAGATGAAGACGTAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022985.6-346s21c1
Sequence:CCGGCAGTAGCAATGGTAGAATAAGCTCGAGCTTATTCTACCATTGCTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022985.6-1394s21c1
Sequence:CCGGTTTCTTTGCACCCACTATTTACTCGAGTAAATAGTGGGTGCAAAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022985.6-787s21c1
Sequence:CCGGTTACTCAGATGTTCACAATTGCTCGAGCAATTGTGAACATCTGAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022985
VALIDATED
ZFAND6 MISSION shRNA Lentiviral Transduction Particles
zinc finger, AN1-type domain 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_022985.3-999s1c1
Sequence:CCGGCCCTTGAATCATGCATGTCATCTCGAGATGACATGCATGATTCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_022985.3-486s1c1
Sequence:CCGGCCTGTGTCAAATCAGTCACTTCTCGAGAAGTGACTGATTTGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_022985.3-1208s1c1
Sequence:CCGGGCGTTGATCTTGCAGTTTATTCTCGAGAATAAACTGCAAGATCAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022985.6-305s21c1
Sequence:CCGGATGTGTTCAGTATGCTATAAACTCGAGTTTATAGCATACTGAACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022985.6-281s21c1
Sequence:CCGGTATGGAAACCCTCGTACAAATCTCGAGATTTGTACGAGGGTTTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_022985.6-455s1c1
Sequence:CCGGGATTCTACGTCTTCATCTATGCTCGAGCATAGATGAAGACGTAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022985.6-346s21c1
Sequence:CCGGCAGTAGCAATGGTAGAATAAGCTCGAGCTTATTCTACCATTGCTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022985.6-1394s21c1
Sequence:CCGGTTTCTTTGCACCCACTATTTACTCGAGTAAATAGTGGGTGCAAAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022985.6-787s21c1
Sequence:CCGGTTACTCAGATGTTCACAATTGCTCGAGCAATTGTGAACATCTGAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019006
VALIDATED
ZFAND6 MISSION shRNA Bacterial Glycerol Stock
zinc finger, AN1-type domain 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_019006.x-795s1c1
Sequence:CCGGGAATGCCGGTGTGGAAATGTTCTCGAGAACATTTCCACACCGGCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_019006.x-797s1c1
Sequence:CCGGATGCCGGTGTGGAAATGTTTACTCGAGTAAACATTTCCACACCGGCATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_019006.x-858s1c1
Sequence:CCGGTACAATTACAAAGCCGATGCTCTCGAGAGCATCGGCTTTGTAATTGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_019006.x-477s1c1
Sequence:CCGGAGTAGTCTGTCTGAATCTTTACTCGAGTAAAGATTCAGACAGACTACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019006.x-786s1c1
Sequence:CCGGACTGGGTTTGAATGCCGGTGTCTCGAGACACCGGCATTCAAACCCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_019006.2-372s21c1
Sequence:CCGGTATGGAAACCCTCGTACAAATCTCGAGATTTGTACGAGGGTTTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_019006.2-1435s21c1
Sequence:CCGGTTTCTTTGCACCCACTATTTACTCGAGTAAATAGTGGGTGCAAAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_019006.2-797s21c1
Sequence:CCGGATGCCGGTGTGGAAATGTTTACTCGAGTAAACATTTCCACACCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_019006.2-394s21c1
Sequence:CCGGGCATGTGTTCAGTATGCTATACTCGAGTATAGCATACTGAACACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_019006.2-477s21c1
Sequence:CCGGAGTAGTCTGTCTGAATCTTTACTCGAGTAAAGATTCAGACAGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019006
VALIDATED
ZFAND6 MISSION shRNA shRNA Plasmid DNA
zinc finger, AN1-type domain 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_019006.x-795s1c1
Sequence:CCGGGAATGCCGGTGTGGAAATGTTCTCGAGAACATTTCCACACCGGCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_019006.x-797s1c1
Sequence:CCGGATGCCGGTGTGGAAATGTTTACTCGAGTAAACATTTCCACACCGGCATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_019006.x-858s1c1
Sequence:CCGGTACAATTACAAAGCCGATGCTCTCGAGAGCATCGGCTTTGTAATTGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_019006.x-477s1c1
Sequence:CCGGAGTAGTCTGTCTGAATCTTTACTCGAGTAAAGATTCAGACAGACTACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019006.x-786s1c1
Sequence:CCGGACTGGGTTTGAATGCCGGTGTCTCGAGACACCGGCATTCAAACCCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_019006.2-372s21c1
Sequence:CCGGTATGGAAACCCTCGTACAAATCTCGAGATTTGTACGAGGGTTTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_019006.2-1435s21c1
Sequence:CCGGTTTCTTTGCACCCACTATTTACTCGAGTAAATAGTGGGTGCAAAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_019006.2-797s21c1
Sequence:CCGGATGCCGGTGTGGAAATGTTTACTCGAGTAAACATTTCCACACCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_019006.2-394s21c1
Sequence:CCGGGCATGTGTTCAGTATGCTATACTCGAGTATAGCATACTGAACACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_019006.2-477s21c1
Sequence:CCGGAGTAGTCTGTCTGAATCTTTACTCGAGTAAAGATTCAGACAGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019006
VALIDATED
ZFAND6 MISSION shRNA Lentiviral Transduction Particles
zinc finger, AN1-type domain 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_019006.x-795s1c1
Sequence:CCGGGAATGCCGGTGTGGAAATGTTCTCGAGAACATTTCCACACCGGCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_019006.x-797s1c1
Sequence:CCGGATGCCGGTGTGGAAATGTTTACTCGAGTAAACATTTCCACACCGGCATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_019006.x-858s1c1
Sequence:CCGGTACAATTACAAAGCCGATGCTCTCGAGAGCATCGGCTTTGTAATTGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_019006.x-477s1c1
Sequence:CCGGAGTAGTCTGTCTGAATCTTTACTCGAGTAAAGATTCAGACAGACTACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019006.x-786s1c1
Sequence:CCGGACTGGGTTTGAATGCCGGTGTCTCGAGACACCGGCATTCAAACCCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_019006.2-372s21c1
Sequence:CCGGTATGGAAACCCTCGTACAAATCTCGAGATTTGTACGAGGGTTTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_019006.2-1435s21c1
Sequence:CCGGTTTCTTTGCACCCACTATTTACTCGAGTAAATAGTGGGTGCAAAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_019006.2-797s21c1
Sequence:CCGGATGCCGGTGTGGAAATGTTTACTCGAGTAAACATTTCCACACCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_019006.2-394s21c1
Sequence:CCGGGCATGTGTTCAGTATGCTATACTCGAGTATAGCATACTGAACACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_019006.2-477s21c1
Sequence:CCGGAGTAGTCTGTCTGAATCTTTACTCGAGTAAAGATTCAGACAGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks